Walk-in-Interview

Walk-in-interview will be held on February 11, 2014 at 10:00 A.M. at IASRI, New Delhi for a project “Whole Genome Sequencing and Development of Allied Genomics Resources in Two Commercially Important Fish-Labeo rohita and Clarias batrachus” funded by Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi for the following posts. The appointment will be on contractual basis upto September, 2016 or till the termination of the project whichever is earlier and the incumbent shall not have any claim for regular appointment under ICAR.

Senior Research Fellow Two

Post-Graduation in Bioinformatics/ Agricultural Statistics/ Statistics/ Computer Science/ Computer Application/ Biotechnology or equivalent with 1st Division

 Knowledge of Statistical Analysis /Bioinformatics tools/computer programming for computational genomics.

Emoluments for Research Associate: Consolidated Rs: 16000/- per month + 30% HRA (1st Two years) and Rs: 18000/- per month + 30% HRA (3rd Year)

Age Limit: Age should be not more than 35 years (5 years relaxation for SC/ST/women candidates and 3 years for OBC candidates as on date of interview).
Interested candidates are requested to appear for Walk-in-Interview on the date and time as specified above in Room No. 106, Training Cum Administrative Block of the Institute along with their application giving bio-data with attested copies of certificates, degrees, testimonials, etc. and one passport size photograph. Original certificates/ Degrees are needed to be produced at the time of interview. No T.A. /D.A. will be paid for appearing in the interview.

Advertisement: http://www.iasri.res.in/employment/2014/srf_cabin.pdf

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Candidates having the below mentioned qualifications may appear for Walk in Interview at ICPO on 5th Feb 2014 between 10.00 AM and 12.00 PM under the NIF project entitled "Prediction of drug tragets of chemical constituents present within non-codified medicinal plants" under Dr Subhash M.Agarwal, Scientist C

Position : JRF
No of Post : One
Pay : Rs 12000/- + 30% HRA

Desired Profile : M.Sc in Bioinformatics with good academic record. Candidate with experience in database development and scripting would be preferred
Age Limit : Below 28 years
Period : 2 months

Interested candidates may send their applications with bio-data by email (smagarwal@gmail.com) or post addressed to Dr Subhash M Agarwal, Scientist C, Bioinformatics Division, Institute of Cytology and Preventive Oncology (ICPO) I-7, Sector 39, Noida-201301 so as to reach latest by 04.02.14

Deadline : 04.02.14

http://icmr.nic.in/icmrnews/icpo_jrf.pdf

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

* Analysis of Gene Expression Pattern Images: high-performance image analysis and mining for different model organisms, such as fruitfly, C. elegans, and mouse;
* Feature/Model Learning: developing algorithms and software

Location :Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, Virginia, USA.

http://research.janelia.org/peng/

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser

This position will have a significant focus on providing analytical support for next generation sequencing data analysis – Exome-sequencing, Targetted sequencing as well as high-throughput genotyping on Illumina platform.

Job location:

Genome Research Chair
King Saud University, Riyadh-11451
KSA

Interested candidate may forward their CV to grcksu@gmail.com

It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.

 Please comment if you know any other long read addembly tutorial.

Address of the bookmark: http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/

Required Qualifications: Masters in physics/chemistry/mathematics (or) MTech in bioengineering, chemical (or) Masters in any traditional field of science with outstanding performance throughout the program. Candidate should have cleared GATE/UGC-CSIR examinations. Applicant should have done basic mathematics courses like calculus, differential equations, numerical analysis etc in their degree program and have obtained good grades in those courses. Knowledge of MATLAB and C or at least one traditional programming language is absolutely necessary. Strong inclination to understand biological concepts is a must for this research work as this project is about modeling biological systems.

Salary: A fixed salary of Rs 18000 PM including HRA will be paid.

Last date for application: This advertisement is open until suitable candidate is found for the project.

Preferred Qualifications: - Expertise in dynamical systems theory, bifurcation theory, numerical simulations, parameter estimation.

Independence and high motivation for carrying out interdisciplinary research. - Excellent communication skills and ability to work independently. - Good working habits.

Interested candidates should submit both curriculum vitae and statement of interest in PDF format to sriramk@iiitd.ac.in and should clearly mention in the subject "Application for SRF".

Address of the bookmark: https://github.com/rhysf/Synima