<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28199?offset=540</link>
	<atom:link href="https://bioinformaticsonline.com/related/28199?offset=540" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5574/srfjrfra-university-of-hyderabad</guid>
  <pubDate>Mon, 14 Oct 2013 07:49:11 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF/JRF/RA @ UNIVERSITY OF HYDERABAD]]></title>
  <description><![CDATA[
<p>SCHOOL OF CHEMISTRY, UNIVERSITY OF HYDERABAD</p>

<p>Applications on plain paper along with details of CV (relevant photocopies of their<br />qualifications/experience and reprints of published work to be attached) are invited from qualified candidates for Research Fellowship in CSIR- sponsored research project.</p>

<p>JRF/SRF/RA (one vacancy)</p>

<p>CSIR sponsored “In silico design, identification and in vitro validation of lead molecule inhibitors to Bcr-Abl kinase”</p>

<p>JRF: M.Sc in Chemistry/ Bioinformatics/ Biotechnology with I division and NET or GATE qualified</p>

<p>SRF: M.Sc in chemistry/ Bioinformatics/ Biotechnology with at least two years of post- M.Sc research experience as evidenced from published papers in standard refereed journals in relevant area</p>

<p>RA: PhD in chemistry/ Bioinformatics/ Biotechnology with research experience in<br />relevant area.</p>

<p>As per CSIR guidelines</p>

<p>Notes:<br />1) You may visit the University of Hyderabad website www.uohyd.ernet.in to learn more about the University of Hyderabad.<br />2) Applicants should note that the appointment to be made is purely temporary and there is no right for claiming for any regular appointment in the University.<br />3) No TA/DA will be paid for attending the interview or at the time of joining the post, if selected.<br />4) The application should be submitted by post/courier/in-person to the address given below on or before November 1st 2013.</p>

<p>Prof. Lalitha Guruprasad<br />W-103, Gurbakhsh Singh Building<br />School of Chemistry<br />University of Hyderabad<br />Hyderabad- 500 046<br />5) Short-listed candidates will be called for interview at a short notice.</p>

<p>Advertisement: http://www.uohyd.ac.in/images/recruitment/chemisry_advt_101013.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44640/new-blast-core-nucleotide-database-core-nt</guid>
	<pubDate>Tue, 13 Aug 2024 07:12:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44640/new-blast-core-nucleotide-database-core-nt</link>
	<title><![CDATA[New BLAST Core Nucleotide Database (core_nt)]]></title>
	<description><![CDATA[<p><span>The Core Nucleotide Database (core_nt) is now the default nucleotide BLAST database. Core_nt is also available on the command line. You get faster searches &amp; more focused results.</span></p><p><span><span>Core_nt contains the same eukaryotic transcript and gene-related sequences as nt. The core_nt database is nt without most eukaryotic chromosome sequences. Most nucleotide BLAST searches with core_nt will be similar to the nt database. However, core_nt is better than nt for accomplishing your most common BLAST search goals, such as identifying gene-related sequences like transcript sequences and complete bacterial chromosomes. This is because, in recent years, nt has acquired more low-relevance, non-annotated, and non-gene&nbsp;<span>content.&nbsp;</span></span></span></p><p><span> Learn more:&nbsp;https://ncbiinsights.ncbi.nlm.nih.gov/2024/07/18/new-blast-core-nucleotide-database/</span></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5702/research-fellow-in-bioinformatics-queens-university-belfast-institute-for-global-food-security-school-of-biological-sciences</guid>
  <pubDate>Thu, 17 Oct 2013 04:33:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellow in Bioinformatics @  Queen's University Belfast -Institute for Global Food Security, School of Biological Sciences]]></title>
  <description><![CDATA[
<p>Ref: 13/102900</p>

<p>Available immediately until 30th November 2015, to work on the development of bioinformatics approaches to aid analysis of data derived from the metabolomic profiling of biological matrices. The successful applicant will lead research activities on an FP7 funded EU-wide collaborative project aimed at establishing biomarker-based strategies for high throughput diagnostic screening. Key tasks will involve multivariate analysis of large datasets, bioinformatic-based selection and validation of identified markers, construction of metabolomic spectral profile databases and development of machine learning/database searching approaches amenable to analytical screening techniques. This position will offer the opportunity to travel and undertake work with project collaborators based in the Republic of Ireland and Europe.</p>

<p>Informal enquiries may be directed to Dr Terry McGrath, email: terry.mcgrath@qub.ac.uk.</p>

<p>Anticipated interview date: Thursday 31st October 2013<br />Salary scale: £30,424 – £39,649 per annum (including contribution points)<br />Closing date: Monday 21st October 2013  </p>

<p>Telephone (028) 90973044 FAX: (028) 90971040 or e-mail on personnel@qub.ac.uk</p>

<p>The University is committed to equality of opportunity and to selection on merit.  It therefore welcomes applications from all sections of society and particularly welcomes applications from people with a disability. </p>

<p>Fixed term contract posts are available for the stated period in the first instance but in particular circumstances may be renewed or made permanent subject to availability of funding.</p>

<p>More @ https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open?VACANCY_ID=5616943npO&amp;WVID=6273090Lgx&amp;LANG=USA</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</guid>
	<pubDate>Mon, 10 Dec 2018 08:29:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</link>
	<title><![CDATA[BLAST options, setting and defaults]]></title>
	<description><![CDATA[<p>BLAST stands for Basic Local Alignment Search Tool and was developed by Altschul et al. (1990) and significantly improved by&nbsp;<a href="http://www3.oup.co.uk/nar/Volume_25/Issue_17/freepdf/">Altschul et al. (1997).</a>&nbsp;It is a very fast search algorithm that is used to separately search protein or DNA databases. BLAST is best used for sequence similarity searching, rather than for motif searching. For searches using a query sequence of fewer than twenty residues,&nbsp;<a href="https://www.arabidopsis.org/servlets/tools/patmatch/">PatMatch</a>&nbsp;is the best choice. Another sequence alignment tool that may yield different results from BLAST, and may be useful for motif searching, is&nbsp;<a href="https://www.arabidopsis.org/cgi-bin/fasta/TAIRfasta.pl">FASTA</a>. To search nonplant datasets, try&nbsp;<a href="http://seqsim.ncgr.org/newBlast.html">NCGR BLAST</a>&nbsp;or&nbsp;<a href="http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=0">NCBI BLAST</a>.</p>
<p>A fairly complete on-line guide to BLAST searching can be found at the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html">NCBI BLAST Help Manual</a>. For a theoretical overview of BLAST, see the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html">NCBI BLAST Course</a>. Additional information can be found in the&nbsp;<a href="https://www.arabidopsis.org/blast/aboutblast2.htm">BLAST 2.0 Release Notes</a></p>
<table border="1">
<tbody>
<tr><th>&nbsp;</th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTP</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">PSIBLAST</a></th></tr>
<tr>
<td><a name="open" id="open"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#open"><strong>Gap opening penalty</strong></a>:<br>cost to open a gap [integer]</td>
<td align="center">default = 5</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 5</td>
</tr>
<tr>
<td><a name="extend" id="extend"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#extend"><strong>Gap extension penalty</strong></a>:<br>cost to extend a gap [integer]</td>
<td align="center">default = 2</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 2</td>
</tr>
<tr>
<td><a name="match" id="match"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#match"><strong>Nucleic match</strong></a>:<br>reward for a match in the BLAST portion of run [integer]</td>
<td align="center">default = 1</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = 1</td>
</tr>
<tr>
<td><a name="mismatch" id="mismatch"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#mismatch"><strong>Nucleic mismatch</strong></a>:<br>penalty for a mismatch in the blast portion of run [integer]</td>
<td align="center">default = -3</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = -3</td>
</tr>
<tr>
<td><strong><a name="expect" id="expect"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#expect">Expectation value</a></strong>:<br>(E) [real]</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
</tr>
<tr>
<td><a name="word" id="word"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#word"><strong>Word size</strong></a>:<br>the size of the initial word that must be matched between the database and the query sequence</td>
<td align="center">default = 11</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 11</td>
</tr>
<tr>
<td><a name="descriptions" id="descriptions"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#descriptions"><strong>Max scores</strong></a>:<br>Number of one-line descriptions (V) [Integer]</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
</tr>
<tr>
<td><strong><a name="alignments" id="alignments"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#alignments">Max alignments</a></strong>:<br>number of alignments to show (B) [integer]</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
</tr>
<tr>
<td><strong>Query filter</strong>:<br>filter applied to the query sequence</td>
<td align="center">default = DUST</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = DUST</td>
</tr>
<tr>
<td><strong><a name="gencodes" id="gencodes"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#gencodes">Query genetic code</a></strong>:<br>genetic code to be used in BLASTX translation of the query</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">n/a</td>
</tr>
<tr>
<td><strong><a name="matrix" id="matrix"></a><a href="http://twod.med.harvard.edu/seqanal/matrices.html">Matrix</a></strong>:<br>substitution matrix to be used for amino acid comparisons</td>
<td align="center">no default</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">no default</td>
</tr>
</tbody>
</table>
<p>Supported and Suggested&nbsp;Values&nbsp;for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX</p>
<table border="1">
<tbody>
<tr><th>Gaps Open</th><th>Gap Extension</th></tr>
<tr>
<td align="center">10</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">10</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">11</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">8</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">9</td>
<td align="center">2</td>
</tr>
</tbody>
</table><p>Address of the bookmark: <a href="https://www.arabidopsis.org/Blast/BLASToptions.jsp" rel="nofollow">https://www.arabidopsis.org/Blast/BLASToptions.jsp</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5947/jrf-national-jalma-institute-of-leprosy-and-other-mycobacterial-diseases</guid>
  <pubDate>Mon, 28 Oct 2013 10:42:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF @ NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES]]></title>
  <description><![CDATA[
<p>NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES</p>

<p>(INDIAN COUNCIL OF MEDICAL RESEARCH)</p>

<p>P.O BOX 101,<br />Dr. M. Miyazaki Marg,<br />Tajganj, Agra - 282001</p>

<p>Applications are invited for a walk-in interview to be held in the Seminar Hall of the on 15th November, 2013, 9:30 am for temporary positions of JRF, Lab Technician and Field attendant in a ICMR funded project entitled "Elucidating the strain differentiation and transmission dynamics of M. leprae through simple sequence repeats ISSR-PCR marker"</p>

<p>1. JRF (one Post)</p>

<p>    Essential qualification: Candidates with M.Sc/IVI.Tech or equivalent degree in any life science related subjects with UGC-CSIR/ICMR/DBT-Net qualified</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age. Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs. 6,000 + 20% HRA per Month</p>

<p>2. Lab Technician (One Post)</p>

<p>    Essential Qualification: 12th with DMLT/B.SCA4.SC in Life sciences</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age: Maximum 30 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs13,760/ Per Month</p>

<p>3. Field Attendant (One Post)</p>

<p>Essential Qualification: 10th Pass</p>

<p>Desirable Qualification: Experience in field work</p>

<p>Age: Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>Emoluments: Rsl2,040l Per Month</p>

<p>Terms: posts are purely temporary. Appointment will be initially made for a period of one (01) year and may be extended further based on the performance of the candidate up to completion of the project.</p>

<p>Application &amp; Selection procedure: candidates have to appear in the walk-in-interview in person along with an application/CV on plain paper giving details of at educational qualificationq experience and submit photocopies of relevant documents at the time of interview. Selection will be based on the performance of the candidate in the interview' Candidates will not be sent any interview call letter separately. No TA/DA will be paid to the candidate for appearing in the interview. selection is not possible without appearing in the interview. All candidates must report by 9:00am on the date of interview. Advance copy of CV may be sent to m.sarathipartha@gmail.com</p>

<p>Advertisement: http://www.jalma-icmr.org.in/P_S_M_advertisment.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</guid>
	<pubDate>Wed, 30 Aug 2023 02:36:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44370/ncbiblast-2141-now-available</link>
	<title><![CDATA[NCBIBLAST+ 2.14.1 now available]]></title>
	<description><![CDATA[<p><a href="https://www.linkedin.com/feed/hashtag/?keywords=ncbiblast&amp;highlightedUpdateUrns=urn%3Ali%3Aactivity%3A7101231946264924160">#NCBIBLAST</a><span>+ 2.14.1 now available with improved documentation, faster and more reliable database downloads, and some bug fixes.&nbsp;</span></p><p>Check out the changes they made.</p><p>They added the&nbsp;<code><span>cleanup-blastdb-volumes.py</span></code>&nbsp;script to remove unused BLAST database volumes. Read the documentation&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK592857/">here</a>.</p><p>They also switched the protocol from&nbsp;<code><span>ftp</span></code>&nbsp;to&nbsp;<code><span>https</span></code>&nbsp;to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the&nbsp;<code><span>update_blastdb.pl</span></code>&nbsp;script.</p><p>And fixed a few bugs related to downloading data from the NCBI, and&nbsp;<code><span>mt_mode</span></code>&nbsp;crashing&nbsp;<code><span>blastn</span></code>&nbsp;and&nbsp;<code><span>blastx</span></code>.</p><p>Check out the&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK131777/">release notes</a>.</p><p>Download&nbsp;<a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.14.1/">BLAST+ 2.14.1</a></p><p>Questions or comments? Please write the&nbsp;<a href="https://support.nlm.nih.gov/support/create-case/">BLAST help desk</a>.</p><p><span><span>More info and download:</span>&nbsp;https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7815/post-doc-in-systems-genetics</guid>
  <pubDate>Wed, 08 Jan 2014 19:23:37 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Systems Genetics]]></title>
  <description><![CDATA[
<p>Gagneur lab at Gene Center, Ludwig-Maximilians-Universitaet, Munich, Germany</p>

<p>Deadline for applications : January 15, 2014.</p>

<p>Description :</p>

<p>We seek a talented and motivated post-doc to develop computational methods for inferring the molecular basis of genetic diseases by integration of personal omics data. Research topics include: identifying causal mutations of rare disease patients by meta-analysis; inferring disease-causing molecular pathways from genotype, human phenotypes, and omics profile of patient-derived cell lines; and causal inference from longitudinal omics studies of patients. The developed methods will be applied to analyze data from our medical collaborators.</p>

<p>Candidates must either hold a PhD in computational biology or bioinformatics, or hold a PhD in physics, statistics, or applied mathematics with practical experience with high-dimensional data analysis. Experience in quantitative genetics is a plus. Applicants must have a proven publication record and an interest for translational research.</p>

<p>The Gagneur lab is a young, lively and multidisciplinary group with a research focus on systems genetics and gene regulation. It is located at the Gene Center of the LMU (University of Munich), an interdisciplinary institution whose 16 independent research groups investigate the regulation of gene expression at all levels - from the underlying molecular mechanisms to the biological system. The institute is located on the biomedical research campus Munich-Grosshadern, offering a dynamic, interactive and internationally oriented research environment. The dynamism of Munich and the proximity of the Alps provide an excellent quality of life.</p>

<p>The salary is according to the TV-L (German academic salary scale).<br />Applications including a cover letter, CV, and references must be sent by January 15th 2014 to Julien Gagneur (gagneur@genzentrum.lmu.de)</p>

<p>About the lab: http://www.gagneur.genzentrum.lmu.de</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</guid>
	<pubDate>Tue, 23 Mar 2021 05:32:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</link>
	<title><![CDATA[Public Databases for Bioinformatics !]]></title>
	<description><![CDATA[<pre>https://www.nature.com/articles/s41467-020-17155-y<br><br>Server Infrastructure:

File Server:

dhara: Synology 3614 Storage Appliance
4 Core Xeon
108TB disk storage
10Gb ethernet to SCG3
Access atx: dhara:5000
Has btsync server (try it - its much better than dropbox)

Compute Servers:

nandi: Kundaje and Phi Server
24 intel cores
256GB RAM
500GB of SSD storage 
36TB RAID6 local storage
4 Intel Phi's (space for 4 more GPU's)


durga: Montgomery and sensitive data
24 intel cores
256GB RAM
500GB of SSD RAID0 storage 
60TB RAID6 local storage

mitra: Bassik and Web/DB Server
24 core
256GB RAM 
500GB of SSD RAID0 storage 
36TB RAID6 local storage

vayu: Kundaje GPU server
4 core
64GB RAM 
200GB of SSD storage 
8TB RAID10 local storage
4 Nvidia GTX 970 4GB GPUs

amold: Bickel and SGE server
32 AMD core
128GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

wotan: Bickel and SGE server
64 AMD core
256GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

Filesystem:

/users/$USER
default home directory
full backups nightly 
nfs mount to dhara
should store code, papers, and other highly processed data here

/mnt/data/
globally accessible data
should store common data here
e.g. genomes and indexes, annotations, ENCODE data  
if you dont want this to count towards your quote you must chown

/mnt/lab_data/$LAB/
lab accessible data
should store lab project data here 
e.g. ATAC-seq prediction data, enhancer prediction, motif calls

/srv/scratch/$USER
fast local storage
not backed up, but on raid and data will never be deleted
most analysis should be performed here

/srv/persistent/$USER
fast local storage
synced nightly, but not backed up
       ie if the hard drives fail or you delete something and notice 
       within 24 hours we can recover. Otherwise not. (vs home which is 
       properly backed up )  
intermediate analysis products that would be hard to recover should be stored here 
       e.g. stochastic analysis results that need to be kept so that paper 
       results can be reproduced

/srv/www/$LABNAME/
web accessible from mitra.stanford.edu
*NOT BACKED UP*

Some parallel programming patterns:

# gzip a bunch of files
parallel gzip -- *.FILESTOGZIP

# fork example in python:
(for more detailed examples look at 
 https://github.com/nboley/grit/ grit/lib/multiprocessing_utils.py)

import os
import time
import random

import multiprocessing

class ProcessSafeOPStream( object ):
    def __init__( self, writeable_obj ):
        self.writeable_obj = writeable_obj
        self.lock = multiprocessing.Lock()
        self.name = self.writeable_obj.name
        return
    
    def write( self, data ):
        self.lock.acquire()
        self.writeable_obj.write( data )
        self.writeable_obj.flush()
        self.lock.release()
        return
    
    def close( self ):
        self.writeable_obj.close()

def worker(queue, ofp):
    # Try without this
    random.seed()
    while True:
        i = queue.get()
        if i == 'FINISHED': return
        # simulate an expensive function
        x = random.random()
        time.sleep(x/10)
        print i, x
        ofp.write("%i\t%s\n" % (i, x))

NSIMS = 10000
NPROC = 25

# populate queue
todo = multiprocessing.Queue()
for i in xrange(NSIMS): todo.put(i)
for i in xrange(NPROC): todo.put('FINISHED')

ofp = ProcessSafeOPStream( open("output.txt", "w") )

pids = []
for i in xrange(NPROC):
    pid = os.fork()
    if pid == 0:
       worker(todo, ofp)
       os._exit(0)
    else:
       pids.append(pid)  

for pid in pids:
    os.waitpid(pid, 0)

ofp.close()

print "FINISHED"<br><br></pre>
<p>For use case 1 we obtained the following ENCODE and ROADMAP datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz">https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam">https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam">https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam</a>. Blacklisted regions were obtained from&nbsp;<a href="http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz">http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz</a>. The human genome version hg38 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz</a>.</p>
<p>For use case 2 we used the set of narrowPeak files summarized in&nbsp;<a href="https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt">https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt</a>&nbsp;(archived version v1.0.1). The human genome version hg19 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz</a></p>
<p>For use case 3 we used the ENCODE datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam">https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig">https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam">https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam</a>&nbsp;as we as the GENCODE annotation v29 from&nbsp;<a href="ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz">ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz</a>.</p><p>Address of the bookmark: <a href="http://mitra.stanford.edu/" rel="nofollow">http://mitra.stanford.edu/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>