Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html

https://academic.oup.com/bib/article/22/3/bbaa123/5868070

Address of the bookmark: https://github.com/hzi-bifo/Quasimodo

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Please take a look at our FAQ section and do not hesitate to report bugs or suggestions for improvements by email.

Address of the bookmark: https://chlorobox.mpimp-golm.mpg.de/OGDraw.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Address of the bookmark: https://github.com/envgen

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.