BOL: Related items

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Genome assembly training tutorial at Galaxy !

Jit — Sun, 27 Dec 2020 05:25:45 -0600

In this tutorial we assemble and annotate the genome of E. coli strain C-1. This strain is routinely used in experimental evolution studies involving bacteriophages. For instance, now classic works by Holly Wichman and Jim Bull (Bull 1997, Bull 1998, Wichman 1999) have been performed using this strain and bacteriophage phiX174.

Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html

QuasiModo - Quasispecies Metric Determination on Omics

Neel — Sat, 26 Jun 2021 15:22:56 -0500

This repository contains the scripts and pipeline that reproduces the results of the HCMV benchmarking study. In this study we evaluated genome assemblers and variant callers on 10 in vitro generated, mixed strain HCMV sequence samples, each consisting of two lab strains in different abundance ratios. This tool can also be used to evaluate assemblies and variant calling results on other similar datasets.

https://academic.oup.com/bib/article/22/3/bbaa123/5868070

Address of the bookmark: https://github.com/hzi-bifo/Quasimodo

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

OGDRAW - Draw Organelle Genome Maps

Abhi — Tue, 05 Oct 2021 03:34:35 -0500

OrganellarGenomeDRAW converts annotations in the GenBank or EMBL/ENA format into graphical maps. The input has to be a GenBank or EMBL/ENA flat file wherase the output can vary among several types of files. The application is optimized to create detailed high-quality maps of organellar genomes (plastid and mitochondria). Nevertheless, you can upload most database entries.

Please take a look at our FAQ section and do not hesitate to report bugs or suggestions for improvements by email.

Address of the bookmark: https://chlorobox.mpimp-golm.mpg.de/OGDraw.html

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Comparative Genomics Workshops !

Rahul Nayak — Tue, 25 Jan 2022 20:39:58 -0600

This meeting's objective was to obtain a big picture look at the current state of the field of comparative genomics with a focus on commonalities across genomic investigations into humans, model organisms (both traditional and non-traditional), agricultural species, wildlife species and microbes.

https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Environmental Genomics Group SciLifeLab/KTH Stockholm

BioStar — Thu, 01 Dec 2022 01:12:43 -0600

Useful Metagenomics resources

Address of the bookmark: https://github.com/envgen

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl