Eligibility:
M.Sc. in any stream of Life Sciences with minimum 55% marks.

Desirable:
Candidates having experience in Molecular Spectroscopy, Protein Folding and Bioinformatics will be preferred.

Interested candidate may appear in the walk in Interview conducted on September 16, 2014 (Tuesday) 11:00 AM in the Director's Office, Centre for Interdisciplinary Research in Basic Sciences, lamia Millia Islamia, New Delhi-110025.
Candidates are required to bring a set of Xerox copy of their recent CV and qualifying degree (certificate/mark sheet) along with original documents. NoTA/DA will be paid.

For any further information you may e-mail to: mihassan@jmLac.in

Read more at http://jmi.ac.in/upload/advertisement/jobs_cirbs_2014september8.pdf

(Deemed University)

Hamdard Nagar, New Delhi – 110 062

R E C R U I T M E N T

(Advertisement No. 5/2014)

Applications on prescribed form are invited for filling up the following teaching positions in the Department of Biotechnology, Faculty of Science in the university. Eligible candidates may apply on or before 30.09.2014.

1. Professor/Associate Professor - One in Pay Band of Rs. 37400-67000+ AGP Rs.10000/9000

2. Assistant Professor - Two in Pay Band of Rs. 15600-39100+ AGP Rs. 6000/-

ASSISTANT PROFESSOR – 02 (including 01 SFS)

Specialization : Bioinformatics

Qualification and Experience :

Ph.D. in Biotechnology or an allied discipline with M.Sc. in Biotechnology/ Biochemistry in the First division or equivalent grade from a recognized University/ Institute.

NET in Life Science or allied discipline in addition to the above qualification.

Experience : At least two years of Post-doctoral teaching and/or research experience in Bioinformatics or relevant field in a UGC recognized Institution of repute or international research institute/ University. Proof of research to be evidenced by publications in SCI-indexed journals of high impact factor as the first or corresponding author.

Note : University may consider exempting candidates from NET, who has been awarded Ph.D. degree from ‘A’ Grade accredited University following the procedure as notified by the UGC in its Regulations of 2009 and adopted by Jamia Hamdard.

For more information: http://www.jamiahamdard.ac.in/PDF/Online%20application%20form%20_Teaching_1.pdf
http://www.jamiahamdard.ac.in/PDF/PBAS.pdf

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Functional and Comparative Genomics

http://jp.senescence.info/
http://www.senescence.info/
http://www.liv.ac.uk/integrative-biology/staff/joao-de-magalhaes/

Extent of employment: 30 Hours per Week
Duration of employment: 1st of October 2015 to 30th of September 2019
Gross monthly salary and pay grade in terms of collective agreement for university staff (payable 14 times per year): B1, € 1.997,20

Responsibilities
The successful candidate (f/m) will pursue a Ph.D. project related to the interpretation of plant genome and transcriptome sequencing data from next-generation sequencing (NGS) platforms. In particular, the candidate will characterize the unexplored genome of quinoa, a crop plant of long-standing tradition in Latin America. We collaborate with research partners in Austria and abroad, and the candidate’s project will be of central importance in the context of this research network.

Required skills and qualifications
We are looking for a graduate student (f/m) with a Master’s degree in bioinformatics or in a related field, solid programming skills (e.g. developing sequence analysis tools), experience with the analysis of NGS data sets, understanding of lab methods and knowledge of genomics/transcriptomics. The group has successfully performed several projects using NGS technology. We have recently published the reference genome sequence of sugar beet (Dohm et al., Nature, 2014), a crop plant closely related to quinoa (same family, but different genus). Not yet published is a quinoa genome assembly that we have generated, and which will serve as the starting point of the candidate’s project. We are a multidisciplinary team and offer work in a lively and friendly atmosphere, and state-of-the-art computing infrastructure. We are looking forward to expanding our team by a dedicated and strongly motivated person with a distinct interest in the challenges of plant genomics.

Applications can be submitted until: 16th of August 2015

University of Natural Resources and Life Sciences Vienna seeks to increase the number of its female faculty and staff members. Therefore qualified women are strongly encouraged to apply. In case of equal qualification, female candidates will be given preference unless reasons specific to an individual male candidate tilt the balance in his favour.

Please send your job application (incl. letter of motivation, CV, summary of Master’s thesis and contact details for two referees) to Personnel department, University of Natural Resources and Life Sciences, 1190 Vienna, Peter-Jordan-Straße 70; E-Mail: kerstin.buchmueller@boku.ac.at. (Reference code: 59)

We regret that we cannot reimburse applicants travel and lodging expenses incurred as part of the selection and hiring process.

www.boku.ac.at

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

• Updated human gene set (GENCODE 21)
• Updated rat gene set including manual annotation from HAVANA
• New species: Vervet-African green monkey
• Imported Transcript Support Levels (TSLs) from UCSC for human and mouse
• Imported APPRIS flag for human and mouse
• Updated Amazon molly gene set

Find more at http://www.ensembl.info/blog/2014/10/02/ensembl-77-has-been-released/

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py

Qualified and interested candidates can send their curriculum vitae by e-mail to hr@drils.org on or before 27th October 2014 mention in the subject line of the mail the following code: AMPK-Biology.

Selected candidates will be called for a personal interview to Dr. Reddy’s Institute of Life Sciences, University of Hyderabad Campus, Gachibowli, Hyderabad. The selected candidate is expected to report within two weeks from the date of selection to start work on the project.

Junior Research Fellowship (Molecular Modeling/Biology) for two years and Senior Research fellowship for one year

Junior Research Fellowship: Rs. 15,600/- (consolidated) per month for first two years.
Senior Research Fellowship: Rs. 18,200/-(consolidated) per month for the 3rd year.

Duration: The duration of the fellowship is for three years. However, the performance of the candidate will be reviewed after the completion of every year and the fellowship will be renewed only upon satisfactory performance.

Responsibilities:

1) Literature search.
2) Design, plan and execute experiments under the supervision of the scientist.
3) Provide scientific support to the scientist in his/her research activities.
4) Book keeping and maintenance of stocks and consumables.

Essential Qualifications:

Required: M.Sc. in Microbiology/Biotechnology/Bioinformatics or any other related branch of basic Sciences from a recognized university/institute with a consistent academic record of minimum 60% aggregate in all qualifying examinations. The candidate should be NET qualified for lectureship. The candidate should be motivated to work with dedication.

Desirable: expertise/experience in both Molecular Modeling and Molecular Biology.

Experience: 0-2 years in the areas of Molecular Modeling and/or Molecular Biology and cell biology and Biochemistry.

Preferable: Relevant research experience as evident from thesis/dissertation/project work.

Advertisement: http://www.ilsresearch.org/userfiles/Junior%20REsearch%20Fellowship%20-%20AMPK(Biology).pdf