<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28269?offset=530</link>
	<atom:link href="https://bioinformaticsonline.com/related/28269?offset=530" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14899/post-doc-positions-at-the-institute-of-evolution-university-of-haifa-haifa-israel</guid>
  <pubDate>Thu, 04 Sep 2014 03:59:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Post-Doc Positions at the Institute of Evolution, University of Haifa, Haifa, Israel]]></title>
  <description><![CDATA[
<p>We are looking for independent, motivated, diligent, laborious, dedicated Bioinformaticians as post-doctorate fellows for a project aimed at revealing the mechanisms of cancer-resistance and anti-cancer activity of the hypoxia-tolerant subterranean, blind mole-rat, Spalax along its underground evolutionary adaptations. Our project has captured the interest of the scientific community and we have ample financial support for the studies. Generous fellowships ($30K to $40K according to qualifications and performance) are available, immediately, for Post-Docs experts in bioinformatics with a background of good understanding biological questions. That is that can independently handle raw output data of RNA-seq / miR seq/ Genomic, analyze it and can interpret intelligently the relevant biological background. Outstanding candidates for PhD experienced in Bioinformatics will also be considered. Familiarity with cancer research is an advantage. Experience of writing manuscripts for publication and a publication record in relevant journals are expected. English skills both oral and written are required. American, Western-European or Israeli education is a significant benefit. </p>

<p>Our present objectives is to identify and isolate the substances secreted by Spalax cells, resolve with which components they interact that are active only on cancer cells, in order to unravel the biological mechanisms and pathways that evolved in Spalax cell machinery and ultimately lead to the death of cancer-cells. The study could attest to be a breakthrough in cancer research, using the long lived, hypoxia- and cancer-tolerant Spalax as a significant biological resource for biomedical research that hopefully could open new horizons in treatment and prevention of cancer in humans. </p>

<p>Contact: The applications should be submitted, together with extended CV and bibliography, summary of past accomplishments, and contact information of 3 referees, to Prof of Research Aaron Avivi (aaron@research.haifa.ac.il) AND Dr. Imad Shams (imadshams@gmail.com). (http://bit.ly/1lywShk) aaron@research.haifa.ac.il </p>

<p>More at http://evolution.haifa.ac.il/index.php/29-people/personal-websites/77-personal-site-avivi</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/15030/software-engineercomputational-biologist-equinome-ltd-dublin-ireland</guid>
  <pubDate>Thu, 04 Sep 2014 19:21:26 -0500</pubDate>
  <link></link>
  <title><![CDATA[Software engineer/Computational Biologist - Equinome Ltd., Dublin, Ireland]]></title>
  <description><![CDATA[
<p>Equinome (www.equinome.com) is the world leader in the research and<br />development of state-of-the-art novel genomic tools to inform the breeding,<br />selection and training of Thoroughbred racehorses. Since its launch in 2010,<br />Equinome has successfully commercialised three performance-related genetic<br />tests, with a pipeline of further genetic tests in development. We work with<br />many of the world's leading racehorse trainers and breeders in Europe,<br />Australasia, USA and South Africa. The company has been featured on CNN,<br />Bloomberg, RTE, BBC, The Guardian, Discovery Channel and Channel 4, among<br />others.</p>

<p>The Role</p>

<p>We are looking for a Software Engineer - Computational Biologist with 3+<br />years' experience in a similar role to design and implement a backend system<br />to support an online individualised genomics interface. This position is a<br />great opportunity for an ambitious, self-motivated individual to work in a<br />demanding, challenging and interesting role.</p>

<p>Position Description:<br />. Participate in planning, design, and implementation of Equinome back<br />end systems and technologies.<br />. Implement interfaces and management tools for back end services.<br />. Manage, analyse, interpret and visualise large genomics data sets.<br />. Work closely with scientific team to develop new features and<br />application enhancements<br />. Design, develop and manage a genomics research database.</p>

<p>Qualification/Experience:<br />. Minimum MSc in Computer Science, Genetics, Bioinformatics or in a<br />related field (A Ph.D qualification would be an advantage).<br />. Proven 3+ years of experience in similar role.<br />. Highly proficient in Python, SQL, MySQL.<br />. Excellent knowledge of mammalian genomics, bioinformatics and<br />statistical/population genetics.<br />. Hands-on experience working with large data sets.<br />. Experience with front-end technologies (HTML/CSS/Javascript) an<br />advantage.<br />. Experience in rapid web application development: e.g. Django.<br />. Knowledge or experience of Unix Scripting and R statistical<br />programming language would be an advantage.<br />. Ability to work with minimum supervision to deliver high-quality<br />code on time.<br />. Fluency in English and good written and communication skills.<br />. Meticulous attention to detail.</p>

<p>Applications should be submitted before Friday, 26 September 2014 using the<br />following link:<br />http://bit.ly/WgbhxS</p>

<p>Note: Full information and application procedure is available at this link:<br />http://bit.ly/WgbhxS</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16313/project-assistant-position-at-jmi</guid>
  <pubDate>Fri, 12 Sep 2014 00:37:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Assistant Position at JMI]]></title>
  <description><![CDATA[
<p>Project Assistant Position (@ Rs.10,000/pm Fixed) is available for one year ina research project funded by the Department of Science and Technology entitled, "Folding and stability of naturally truncated photosynthetic pigment,C- phycoerythrin from cyanobacterium Phormidium tenue", at Centre forInterdisciplinary Research in Basic Sciences, lamia Millia Islamia, New Delhi-110025 under' the supervision of Dr. Md. Imtaiyaz Hassan (PrincipalInvestigator).</p>

<p>Eligibility:<br />M.Sc. in any stream of Life Sciences with minimum 55% marks.</p>

<p>Desirable:<br />Candidates having experience in Molecular Spectroscopy, Protein Folding and Bioinformatics will be preferred.</p>

<p>Interested candidate may appear in the walk in Interview conducted on September 16, 2014 (Tuesday) 11:00 AM in the Director's Office, Centre for Interdisciplinary Research in Basic Sciences, lamia Millia Islamia, New Delhi-110025.<br />Candidates are required to bring a set of Xerox copy of their recent CV and qualifying degree (certificate/mark sheet) along with original documents. NoTA/DA will be paid.</p>

<p>For any further information you may e-mail to: mihassan@jmLac.in</p>

<p>Read more at http://jmi.ac.in/upload/advertisement/jobs_cirbs_2014september8.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17188/jamia-hamdard-bioinformatics-faculty-jobs-2014</guid>
  <pubDate>Sat, 20 Sep 2014 21:00:05 -0500</pubDate>
  <link></link>
  <title><![CDATA[JAMIA HAMDARD Bioinformatics Faculty Jobs 2014]]></title>
  <description><![CDATA[
<p>JAMIA HAMDARD</p>

<p>(Deemed University)</p>

<p>Hamdard Nagar, New Delhi – 110 062</p>

<p>R E C R U I T M E N T</p>

<p>(Advertisement No. 5/2014)</p>

<p>Applications on prescribed form are invited for filling up the following teaching positions in the Department of Biotechnology, Faculty of Science in the university. Eligible candidates may apply on or before 30.09.2014.</p>

<p>1. Professor/Associate Professor - One in Pay Band of Rs. 37400-67000+ AGP Rs.10000/9000</p>

<p>2. Assistant Professor                   -  Two in Pay Band of Rs. 15600-39100+ AGP Rs. 6000/-</p>

<p>ASSISTANT PROFESSOR – 02 (including 01 SFS)</p>

<p>Specialization : Bioinformatics</p>

<p>Qualification and Experience :</p>

<p>Ph.D. in Biotechnology or an allied discipline with M.Sc. in Biotechnology/ Biochemistry in the First division or equivalent grade from a recognized University/ Institute.</p>

<p>NET in Life Science or allied discipline in addition to the above qualification.</p>

<p>Experience : At  least two years of Post-doctoral teaching and/or research experience in Bioinformatics or relevant field in a UGC recognized Institution of repute or international research institute/ University.  Proof of research to be evidenced by publications in SCI-indexed journals of high impact factor as the first or corresponding author.</p>

<p>Note : University may consider exempting candidates from NET, who has been awarded Ph.D. degree from ‘A’ Grade accredited University following the procedure as notified by the UGC in its Regulations of 2009 and adopted by Jamia Hamdard.</p>

<p>For more information: http://www.jamiahamdard.ac.in/PDF/Online%20application%20form%20_Teaching_1.pdf<br />http://www.jamiahamdard.ac.in/PDF/PBAS.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/17500/joao-pedro-de-magalhaes-lab</guid>
  <pubDate>Fri, 26 Sep 2014 19:08:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Joao Pedro de Magalhaes Lab]]></title>
  <description><![CDATA[
<p>Ageing has a profound impact on human society and modern medicine, yet it remains a major puzzle of biology. The goal of my work is to help understand the genetic, cellular, and molecular mechanisms of ageing. In the long term, I would like my work to help ameliorate age-related diseases and preserve health. No other biomedical field has so much potential to improve human health as research on the basic mechanisms of ageing. Please see our lab website for further details about our work and publications. </p>

<p>Functional and Comparative Genomics</p>

<p>http://jp.senescence.info/<br />http://www.senescence.info/<br />http://www.liv.ac.uk/integrative-biology/staff/joao-de-magalhaes/</p>
]]></description>
</item>

</channel>
</rss>