BOL: Related items

RA Bioinformatics at NATIONAL INSTITUTE OF BIOMEDICAL GENOMICS, INDIA

Wed, 26 Jul 2017 03:49:52 -0500

NATIONAL INSTITUTE OF BIOMEDICAL GENOMICS
(An Autonomous Institution of the Government of India)
P.O.: N.S.S., Kalyani 741251, West Bengal

Advertisement No. 137/ESTB/NIBMG/17-18

Position available Project Description: Several positions are available for the project titled: “A unified web-portal for analysis, integration and visualization of multi-omics data”. The goal of this project is to develop a user-accessible resource for integrated analysis and visualization of multi-OMICs data sets (including gene expression, genotype, methylation, microRNA, etc.). Data sets generated on various platforms shall be maintained in a stable database, accessed through standard querying mechanisms, and the results shall be displayed via user-friendly interface. The analysis engine shall run on open-source software (such as R/Bioconductor) developed in-house. All positions are contractual.

Appointment will be initially given for a period of one year which is extendable depending upon performance, availability of funds and requirements of the institute.

Project Code: 20275 Position: (No. of positions available)

Research Associate (3)

Position 1: Ph.D. or equivalent in statistics, computer science, mathematics, bioinformatics, or related subject.
Position 1: Those with experience in database management shall be preferred. Experience with UNIX or GNU/Linux operating system.
Position 1: Creation and maintenance of a database for population- and diseaseassociated variation resource. Development of programmatic interface for querying the database, filtering of the results and identification of genes of interest.

Rs. 36000/- + 10% HRA

Please apply online via web link http://apply.nibmg.ac.in/ (no other form of application will be accepted). The last date of application is 14-08-2017. All letters to attend screening test and /or interview will be sent only to the short-listed candidates by Email only. No correspondence will be made with applicants who are not shortlisted /not called for screening test and /or interview. No TA/DA will be paid for attending the screening test and /or interview.
Detail information at http://www.nibmg.ac.in/academic/Advt_20275.pdf

More Info: http://www.nibmg.ac.in/?q=Project%20Linked%20Personnel

LRSDAY: Long-read Sequencing Data Analysis for Yeasts

Poonam Mahapatra — Mon, 26 Aug 2019 18:07:33 -0500

Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast, Saccharomyces cerevisiae, has many isolates currently being sequenced with long reads.

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Bioinformatics lectures !

Jit — Wed, 29 Nov 2017 05:39:54 -0600

Computational Biology is a huge field of study, that touches upon many distinct algorithmic and biological areas of study. What we are able to cover in this course will depend, in part, on the pace at which we move, which I will attempt to adjust as appropriate. However, here is a tentative list of topics I hope to cover this semester (not necessarily in order).

Optimal sequence alignment (global, local, and glocal alignment &mdash with constant & affine gap penalties
Algorithms and data structures for efficient text indexing and exact search
Heuristics for read alignment and mapping &mdash mapping DNA-seq and RNA-seq reads
Genome assembly &mdash k-mers, De Brujin graph construction and representation, long-read technology and read-overlap graph assembly
Motif finding via Gibbs sampling
Gene finding &mdash statistical models for ab initio and evidence-guided prediction of genes
RNA-seq and transcriptomics &mdash transcript assembly, abundance estimation and differential expression testing
Phylogenetics &mdash The small and large phylogeny problem; parsimony, maximum likelihood and Bayesian methods

Address of the bookmark: https://rob-p.github.io/CSE549F16/lectures/

BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks

Rahul Nayak — Sun, 20 Dec 2020 11:43:45 -0600

With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

India and Germany to begin joint research in the area of 'Bioinformatics in Health Research'

Rahul Nayak — Wed, 17 Jan 2018 14:10:36 -0600

To facilitate bilateral cooperation in biotechnology between the scientific communities of India and Germany, the Department of Biotechnology (DBT) will soon begin collaborative research in the identified priority area of 'Bioinformatics in Health Research' under the programme of Indo-German Cooperation in Health Research.

The purpose of the programme is to stimulate new collaborations, e.g. the preparation of joint projects under national funding programmes. The programme facilitates bilateral cooperation in biotechnology between the scientific communities of India and Germany by way of joint research projects which will encompass bilateral workshops/seminar and exchange visits of scientists.

The programme is being implemented within the agreement of Indo-German cooperation in S&T of 1974, under which the Department of Biotechnology, Government of India and Forschungszentrum Julich BMBH (FZJ), Federal Republic of Germany, have agreed for cooperative programme in biotechnology.

DBT of the Ministry of Science & Technology, Government of India and the Project Management Agency at the German Aerospace Center (DLR-PT, European and International Cooperation), Bonn are the nodal implementing agencies from the Indian and German side respectively.

Through this programme, it is expected that the funded cooperation enables the partners to develop applicable scientific results which can be published and/ or could be commercialised and may lead to formation of joint ventures. All publications, patents coming out of these projects, need to be jointly authored by both Indian and German scientists. All necessary approvals like ethical clearance, HMSC approval from Indian point of view as well as EU, if applicable, from German point of view, e.g. before conducting animal experimentation if any needs to be obtained by PIs before undertaking the project.

Now, both the nodal agencies have invited research proposals in identified priority area of 'Bioinformatics in Health Research' from eligible scientists. Joint research projects are required to be submitted to both the nodal agencies by 15 January 2018. Scientists/faculty members working in regular capacity in universities, national R&D laboratories/institutes and private R&D institutes can be part of this joint research programme. For the private sector, partners from all kind of private sectors are eligible, but financing is limited. For Indian scientists from the private sector, only local hospitality in Germany as part of the exchange visit is available from the German side. For German scientists from the private sector, only travel costs are available for small and medium size enterprises (for definition of SME ref. to 2003/361/EC) as well as local hospitality in India will be borne by themselves.

PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens

LEGE — Wed, 21 Feb 2024 06:15:13 -0600

What is PhyloHerb: PhyloHerb is a wrapper program to process genome skimming data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming.

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

An Introduction to Applied Bioinformatics

Jit — Fri, 02 Mar 2018 04:26:38 -0600

IAB is primarily being developed by Greg Caporaso(GitHub/Twitter: @gregcaporaso) in the Caporaso Lab at Northern Arizona University. You can find information on the courses I teach on my teaching website and information on my research and lab on my lab website.

Address of the bookmark: http://readiab.org/

Step-by-Step Guide to Detect piRNAs Using Bioinformatics

Abhi — Fri, 13 Dec 2024 11:41:46 -0600

Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

Obtain RNA Sequencing Data
Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.
Quality Control (QC)
Use FastQC to assess the quality of raw reads:

fastqc reads.fastq

Evaluate the per-base quality, adapter content, and overrepresented sequences.
Trimming and Adapter Removal
Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

Reference Genome Preparation
Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.
Align Reads
Use Bowtie or STAR for small RNA alignment:

bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
- -v 1: Allows one mismatch.
- -k 1: Reports the best alignment.
Convert SAM to BAM
Convert and sort alignments using SAMtools:

samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

Extract Reads by Size
Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq
Check for Sequence Bias
piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

Generate Overlap Statistics
Use the piPipes tool or custom scripts to calculate overlap:

python ping_pong_overlap.py sorted_reads.bam
Visualize Overlap Distribution
Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

Cluster Identification
Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters
Annotate Genomic Regions
Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

Predict piRNA Targets
Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt
Enrichment Analysis
Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

Validate piRNA Candidates
Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.
Visualize Results
- Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
- Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

Archive Data
Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.
Publish Results
Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

SciLifeLab tutorial for bioinformatics analysis !

Jit — Tue, 17 Apr 2018 04:33:00 -0500

SciLifeLab is a national center for molecular biosciences with focus on health and environmental research.

Courses

Old courses (2012-2014)

Alignment-free sequence comparison tools available for next-generation sequencing data analysis

Abhimanyu Singh — Tue, 07 Nov 2017 05:33:33 -0600

kallisto

Transcript abundance quantification from RNA-seq data (uses pseudoalignment for rapid determination of read compatibility with targets)

Software (C++)

https://pachterlab.github.io/kallisto/

Sailfish

Estimation of isoform abundances from reference sequences and RNA-seq data (k-mer based)

Software (C++)

http://www.cs.cmu.edu/~ckingsf/software/sailfish/

Salmon

Quantification of the expression of transcripts using RNA-seq data (uses k-mers)

https://combine-lab.github.io/salmon/

RNA-Skim

RNA-seq quantification at transcript-level (partitions the transcriptome into disjoint transcript clusters; uses sig-mers, a special type of k-mers)

Software (C++)

http://www.csbio.unc.edu/rs/

Variant calling

ChimeRScope

Fusion transcript prediction using gene k-mers profiles of the RNA-seq paired-end reads

Software (Java)

https://github.com/ChimeRScope/ChimeRScope/wiki

FastGT

Genotyping of known SNV/SNP variants directly from raw NGS sequence reads by counting unique k-mers

Software (C)

https://github.com/bioinfo-ut/GenomeTester4/

Phy-Mer

Reference-independent mitochondrial haplogroup classifier from NGS data (k-mer based)

Software (Python)

https://github.com/danielnavarrogomez/phy-mer

LAVA

Genotyping of known SNPs (dbSNP and Affymetrix's Genome-Wide Human SNP Array) from raw NGS reads (k-mer based)

Software (C)

http://lava.csail.mit.edu/

MICADo

Detection of mutations in targeted third-generation NGS data (can distinguish patients’ specific mutations; algorithm uses k-mers and is based on colored de Bruijn graphs)

Software (Python)

http://github.com/cbib/MICADo

General mapper

Minimap

Lightweight and fast read mapper and read overlap detector (uses the concept of “minimazers”, a special type of k-mers)

Software (C)

https://github.com/lh3/minimap

Assembly

De novo genome assembly

MHAP

Produces highly continuous assembly (fully resolved chromosome arms) from third-generation long and noisy reads (10 kbp) using a dimensionality reduction technique MinHash

Software (Java)

https://github.com/marbl/MHAP

Miniasm

Assembler of long noisy reads (SMRT, ONT) using the Overlap-Layout Consensus (OLC) approach without the necessity of an error correction stage (uses minimap)

Software (C)

https://github.com/lh3/miniasm

LINKS

Scaffolding genome assembly with error-containing long sequence (e.g., ONT or PacBio reads, draft genomes)

Software (Perl)

https://github.com/warrenlr/LINKS/

Read clustering

afcluster

Clustering of reads from different genes and different species based on k-mer counts

Software (C++)

https://github.com/luscinius/afcluster

QCluster

Clustering of reads with alignment-free measures (k-mer based) and quality values

Software (C++)

http://www.dei.unipd.it/~ciompin/main/qcluster.html

Reads error correction

Lighter

Correction of sequencing errors in raw, whole genome sequencing reads (k-mer based)

Software (C++)

https://github.com/mourisl/Lighter

QuorUM

Error corrector for Illumina reads using k-mers

Software (C++)

https://github.com/gmarcais/Quorum

Trowel

Software (C++)

https://sourceforge.net/projects/trowel-ec/

Metagenomics

Assembly-free phylogenomics

AAF

Phylogeny reconstruction directly from unassembled raw sequence data from whole genome sequencing projects; provides bootstrap support to assess uncertainty in the tree topology (k-mer based)

Software (Python)

https://github.com/fanhuan/AAF

kSNP v3

Reference-free SNP identification and estimation of phylogenetic trees using SNPs (based on k-mer analysis)

Software (C)

https://sourceforge.net/projects/ksnp/files/

NGS-MC

Phylogeny of species based on NGS reads using alignment-free sequence dissimilarity measures d2* and d2 S under different Markov chain models (using k-words)

R package

http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html

Species identification/taxonomic profiling

CLARK

Taxonomic classification of metagenomic reads to known bacterial genomes using k-mer search and LCA assignment

Software (C++)

http://clark.cs.ucr.edu/

FOCUS

Reports organisms present in metagenomic samples and profiles their abundances (uses composition-based approach and non-negative least squares for prediction)

Web service Software (Python)

http://edwards.sdsu.edu/FOCUS/

GSM

Estimation of abundances of microbial genomes in metagenomic samples (k-mer based)

Software (Go)

https://github.com/pdtrang/GSM

Mash

Species identification using assembled or unassembled Illumina, PacBio, and ONT data (based on MinHash dimensionality-reduction technique)

Software (C++)

https://github.com/marbl/mash

Kraken

Taxonomic assignment in metagenome analysis by exact k-mer search; LCA assignment of short reads based on a comprehensive sequence database

Software (C++)

https://ccb.jhu.edu/software/kraken/

LMAT

Assignment of taxonomic labels to reads by k-mers searches in precomputed database

Software (C++/Python)

https://sourceforge.net/projects/lmat/

stringMLST

k-mer-based tool for MLST directly from the genome sequencing reads

Software (Python)

http://jordan.biology.gatech.edu/page/software/stringMLST

Taxonomer

k-mer-based ultrafast metagenomics tool for assigning taxonomy to sequencing reads from clinical and environmental samples

Web service

http://taxonomer.iobio.io/

Other

d2-tools

Word-based (k-tuple) comparison (pairwise dissimilarity matrix using d2S measure) of metatranscriptomic samples from NGS reads

Software (Python/R)

https://code.google.com/p/d2-tools/

VirHostMatcher

Prediction of hosts from metagenomic viral sequences based on ONF using various distance measures (e.g., d2)

Software (C++)

https://github.com/jessieren/VirHostMatcher

MetaFast

Statistics calculation of metagenome sequences and the distances between them based on assembly using de Bruijn graphs and Bray–Curtis dissimilarity measure

Software (Java)

https://github.com/ctlab/metafast

BOL: Related items

RA Bioinformatics at NATIONAL INSTITUTE OF BIOMEDICAL GENOMICS, INDIA

LRSDAY: Long-read Sequencing Data Analysis for Yeasts

Bioinformatics lectures !

BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks

India and Germany to begin joint research in the area of 'Bioinformatics in Health Research'

PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens

An Introduction to Applied Bioinformatics

Step-by-Step Guide to Detect piRNAs Using Bioinformatics

Step 1: Prepare Your Data

Step 2: Map Reads to the Genome

Step 3: Identify Small RNAs

Step 4: Detect Ping-Pong Signature

Step 5: Annotate piRNA Clusters

Step 6: Functional Analysis

Step 7: Validation and Visualization

Step 8: Share and Publish Findings

Conclusion

SciLifeLab tutorial for bioinformatics analysis !

Courses

Metagenomics Workshop

Introduction to Bioinformatics Using NGS Data

Introduction to Genome Annotation

De Novo Genome Assembly

RNA-seq course

R Programming Foundations for Life Scientists

Single cell RNA sequencing analysis

Alignment-free sequence comparison tools available for next-generation sequencing data analysis