1. TATA SCHOLARSHIP - Cornell University, New York State, USA
Tata, the Indian multinational conglomerate company, have a foundation known as the Tata Education & Development Trust which has endowed a multi million dollar sum to Cornell University to provide undergraduate scholarships to 20 Indian students every year.  In another example of supporting American universities, the Tata group also pledged US$50 million to Harvard University in recent years, whose executive management programme Ratan Tata attended in the 1970s.  Read more...  

2. BRADMAN FOUNDATION SCHOLARSHIP - University of Wollongong, Australia.
Named after Australia's cricket legend Donald Bradman, the UOW Bradman Foundation Scholarship was launched in 2012, with the help of Adam Gilchrist no less, to offer one successful Indian student each year a 50% reduction in tuition fees.  Read more...  

3. HUAWEI MAITREE SCHOLARSHIPS - Various Universities, China
Along with Tata, Huawei are the other huge corporation to be featured.  China's massive telecoms equipment vendor are involved in these scholarships offered to Indian students studying in China.  In 2013 there are 10 generous scholarships available which provide full tuition fees and living expenses.  The courses on which the scholarships are offered include Science and Technology courses, Social Sciences and Culture and Development courses.  Read more...

4. DR. MANMOHAN SINGH SCHOLARSHIPS - Cambridge University, England, UK
These scholarships have been designed to help budding Indian minds follow in the footsteps of Indian prime minister Manmohan Singh by studying at the prestigious Cambridge University.  The scholarships can be applied to any undergarduate course (with the two exceptions of medicine and veterinary science) and cover everything, i.e. tuition and college fees, living expenses and an additional grant to go towards travel expenses.  Read more...

5. OXFORD AND CAMBRIDGE SOCIETY OF INDIA - Oxford & Cambridge Universities, England, UK
As the name might suggest, these are scholarships available for students wishing to study at Oxford or Cambridge (cleverly known together as Oxbridge).  It is only available for applicants who are completing or have completed a degree at an Indian university, however these scholarships are for both undergraduate and graduate students.  Read more...

6. EDINBURGH NAPIER UNIVERSITY - Scotland, UK
This one applies to all countries in the Indian subcontinent and is for both undergraduate and graduate courses. Edinburgh Napier University offers a merit based discount of £2,000 Pounds.  Read more...

7. SHEFFIELD UNIVERSITY - Sheffield, UK
Provides merit-based scholarships for undergraduate and graduate programmes across all subjects. Read more...

8. INDIA 4EU II - Several Universities across Europe
Pioneered by the European Union and involving partner universities in France, Finland, Germany, Italy, Portugal, Spain and Sweden, the India 4EU II initiative is aimed at encouraging Indian students to study, work and live in Europe.  The initiative is well funded and allows the successful students tuition fees, expenses for living and travel costs as well as insurance during their time at one of the partner universities.  Read more...

9. TRINITY COLLEGE DUBLIN - Ireland
Valid for undergraduate courses in the faculties of Arts, Humanities, Social Sciences, Science, Computer Science or Engineering, the Trinity College Dublin offers Indian students scholarships to the tune of €9,000 per annum over a year degree course.  Read more...

10. UNIVERSITY COLLEGE DUBLIN - Ireland
Another of Ireland and Dublin's finest, the UCD awards one Global Excellence Undergraduate Scholarship which provides the worthy student a substantial 50% towards their tuition fees and is valid for all courses save medicine, radiography and veterinary medicine.  UCD also offers a Global Undergraduate Scholarship scheme for undergrads accepted on science, social sciences, arts and business courses.  This is all thanks to a €250,000 fund that will allow for 57 Indian students to benefit from scholarships at UCD.  Read more...

http://www.disi.unige.it/person/MasulliF/ricerca/PhDinGenova2017.html

The call for some funded positions for the 3 years PhD studies at the Department of Informatics, Bioengineering, Robotics and System Engineering (DIBRIS) in Genova is available at

http://www.studenti.unige.it/postlaurea/dottorati/XXXIII/ENG/

The deadline for applications is June13, 2017 and the PhD courses and fellowships should start on Nov 2017.

Details for the application to the PhD Program in Computer Science and Systems Engineering (CODICE 6608) are at http://phd.dibris.unige.it/csse/index.php/how-to-apply

The research activity of my research group is focused on Computational Intelligence, Machine Learning, Bioinformatics, Systems Biology, and Positive Technology as described at http://www.disi.unige.it/person/MasulliF/ricerca/index.html

The research themes proposed by me and Prof. Stefano Rovetta are:

- Computational Intelligence and Machine Learning (see http://www.disi.unige.it/person/MasulliF/ricerca/Phd2017-T1.html)

- Computational Intelligence and Health and Wellbeing Support( see http://www.disi.unige.it/person/MasulliF/ricerca/Phd2017-T3.html)

You can also propose a different research theme belonging to the research activity of my group.

Looking for self-motivated PhD candidates, interested to the mathematical aspects of their research and to the development of new algorithms for intelligent data analysis, and skilled in programming and in thorough experimental data analysis. They will be part of my research group and will collaborate to our research projects and publications.

Italian and international students interested to work are invited to send their cv and the name/email-addresses of 3 referees to my email address francesco.masulli@unige.it A.S.A.P.

Advertisement No. 137/ESTB/NIBMG/17-18

Position available Project Description: Several positions are available for the project titled: “A unified web-portal for analysis, integration and visualization of multi-omics data”. The goal of this project is to develop a user-accessible resource for integrated analysis and visualization of multi-OMICs data sets (including gene expression, genotype, methylation, microRNA, etc.). Data sets generated on various platforms shall be maintained in a stable database, accessed through standard querying mechanisms, and the results shall be displayed via user-friendly interface. The analysis engine shall run on open-source software (such as R/Bioconductor) developed in-house. All positions are contractual.

Appointment will be initially given for a period of one year which is extendable depending upon performance, availability of funds and requirements of the institute.

Project Code: 20275 Position: (No. of positions available)

Research Associate (3)

Position 1: Ph.D. or equivalent in statistics, computer science, mathematics, bioinformatics, or related subject.
Position 1: Those with experience in database management shall be preferred. Experience with UNIX or GNU/Linux operating system.
Position 1: Creation and maintenance of a database for population- and diseaseassociated variation resource. Development of programmatic interface for querying the database, filtering of the results and identification of genes of interest.

Rs. 36000/- + 10% HRA

Please apply online via web link http://apply.nibmg.ac.in/ (no other form of application will be accepted). The last date of application is 14-08-2017. All letters to attend screening test and /or interview will be sent only to the short-listed candidates by Email only. No correspondence will be made with applicants who are not shortlisted /not called for screening test and /or interview. No TA/DA will be paid for attending the screening test and /or interview.
Detail information at http://www.nibmg.ac.in/academic/Advt_20275.pdf

More Info: http://www.nibmg.ac.in/?q=Project%20Linked%20Personnel

Address of the bookmark: https://github.com/yjx1217/LRSDAY

Address of the bookmark: https://rob-p.github.io/CSE549F16/lectures/

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

Address of the bookmark: http://readiab.org/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.