Address of the bookmark: http://bioinformatics.oxfordjournals.org/content/23/14/1713.full

Position Paper Submission Extension: October 9, 2014 
Regular Paper Authors Notification: November 3, 2014 
Position Paper Authors Notification: November 6, 2014 
Regular and Position Paper Camera Ready and Registration: November 17, 2014 

Address of the bookmark: http://www.bioinformatics.biostec.org/

CENTRE FOR BIOINFORMATICS

PUDUCHERRY

Applications are invited for one Project Assistant to work in the UGC sponsored Research Award "Molecular Docking and Dynamics studies to understand the interacting mechanism of oncogenic 101 protein with its cellular proteins".

The duration for the fellowship is 12months only with consolidated pay ofRs. 5,000 per month.

Application on plain paper with following details: Name, Address, Data of Birth, Father's Name, Nationality, Educational Qualification (SSLC onwards-enclose attested copies of certificate) and Researcb Experience may be addressed to Dr. R. Krishna, Principle Investigator (PI), UGC Research Award, Centre for Bioinformatics, Pondicherry University, Pondicherry - 605 014.

Application should reach in January 261h , 2013.

Essential Qualification: M.Sc. in Bioinformatics/Biophysics with good academic record.

Qualification for Project Fellow:

M.Sc in Bioinformatics/Biophysics.

The person to be considered for appointment as Project Fellow must have second class master degree with a minimum of 55% marks in the subject concerned or a related subject.

The candidate to be appointed as Project Fellows should be below thc age of40 years at the time of appointment.

Desirable Qualification for this Project: Research Experience in Small/Macromolecule Crystallography and Structural Bioinformatics.

For more details, refer the web site: www.pondiuni.edu.in/sites/default/files/BIC-311213.pdf

• Bioconductor – A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [ paper-2004 | web ]
• Biopython – Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the Open Bioinformatics Foundation. Contains the very useful Entrez package for API access to the NCBI databases. [ paper-2009 | web ]
• Bioconda – A channel for the conda package manager specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with conda install) bioinformatics packages. [ paper-2018 | web ]
• BioJulia – Bioinformatics and computational biology infastructure for the Julia programming language. [ web ]
• Rust-Bio – Rust implementations of algorithms and data structures useful for bioinformatics. [ paper-2016 ]
• SeqAn – The modern C++ library for sequence analysis.

(Under Tenure-Track Model)

Open Advt. No IIITA/DIC/16012014

IIIT-Allahabad has several Openings for the Faculty positions at the Assistant Professor level.

It is a regular tenure-track faculty positions for 3-5 years in teaching and research. A regular faculty is expected to engage heavily in research and teaching. The eligibility criteria for regular faculty positions are similar as in IITs. For an Assistant Professor position, a candidate must have a PhD (in IT/Computer Science &/or Engineering/Electrical, Electronics &/or Communication Engineering/etc; for interdisciplinary areas the PhD may be in an appropriate field), plus three years experience. However, for PhDs from a well known University/Institute (e.g. IITs/IISc/TIFR/ISI in India or well known research universities across the world), and a good research/academic record, the 3 years experience requirement may be waived.

The pay scale for faculty is same as in IITs. Other benefits include initiation research grant, travel support, book grant, professional society membership, etc., and personal benefits such as medical/LTC, on campus subsidized family housing with excellent modern infrastructural facilities.

Areas of Interest

IIIT-Allahabad aims to build strong research groups in important and emerging areas in CS/IT/ECE as well as in emerging interdisciplinary areas, and applications are invited in all these areas. Some of the areas of special interest, besides strengthening the existing research areas, are : Software Engineering, Theoretical Computer Science, Cyber Physical Systems, Robotics, Network science, Digital Media, Computational neuroscience, Machine learning, Healthcare informatics, Computational Biology, Communications networks (both at hardware and protocol levels), Circuits (including VLSI, analog, low power, etc), Energy systems and technologies, Biomedical electronics and systems, Computer Architecture, signal/image processing, Embedded and control systems.

Application Process

Interested candidates can apply by sending their detailed CV with list of publications clearly mentioning Journal names and citation index with three references through email entitled “Faculty positions at IIIT Allahabad” to faculty.applications@iiita.ac.in. Do not send your applications in any other email addresses. Applications will be considered regularly, hence there is no deadline for applying.

Important Clarifications on Eligibility

A PhD in CS/IT (or other disciplines, as announced) is the minimum expected requirement for an Assistant Professor.

Advertisement: http://iiita.ac.in/pub/Faculty-Position-IIITA1.pdf

This is a fixed term post for 36 months.

We wish to recruit a highly motivated, postdoctoral scientist to carry out a BBSRC funded project in the laboratory of Dr. Denis Larkin. The project is focused on developing and applying new algorithms to study genome and chromosome evolution in birds, mammals and other vertebrate species using whole-genome sequences and existing algorithms. The post holder will use cutting edge computational and laboratory approaches to generate chromosomal assemblies for sequenced genomes, study chromosomal structures and genome differences between bird and other vertebrate species in attempt to identify species- and clade-specific genome signatures.

Applicants must have a Ph.D. and a track record of success, as indicated by first-author publications in international journals. They must possess excellent organisation skills and be capable of individual initiative and of interacting as part of a team. Applicants with extensive practical experience in bioinformatics or computer science, programming, visualization, handling of large data sets, high-performance computing are encouraged to apply. The post will involve collaboration with a wide range of academic partners both within the UK, EU and worldwide. In addition to leading their own project the post holder will have opportunities to contribute to multiple international genome initiatives.

Experience in programming, bioinformatics and comparative genome analysis is essential. Applicants should have a minimum of a degree and preferably a higher degree in a relevant subject.

The Royal Veterinary College has the largest range of veterinary, para-veterinary and animal science undergraduate and postgraduate courses of any veterinary school in the world and is one of the largest veterinary schools in Europe.

Prospective applicants are encouraged to contact Dr. Denis Larkin, Comparative Biomedical Sciences Department on +442071211906 or email: dlarkin@rvc.ac.uk

We offer a generous reward package.

For further information and to apply on-line please visit our website: www.rvc.ac.uk
Job reference CBS-0025-14A

Closing date: 4 July 2014
Interviews are likely to be held in July 2014

We promote equality of opportunity and diversity within the workplace and welcome applications from all sections of the community.

• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

An Autonomous National Institute under Government of India,
Ministry of Science & Technology
Department of Biotechnology

No: RGCB/ Advt./2014/1
January 24, 2014

Scientist Positions

Group Leader in Computational Biology/Bioinformatics
A highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to analyze complex data sets generated by RGCB scientists and collaborators.

Location: Thiruvananthapuram (Trivandrum)

The above positions will be at the E-II, F or equivalent levels. For senior applicants with an outstanding track record, an option of a contract career path for research excellence at Scientist G or H equivalent level can also be discussed. All positions will initially be for 5 years. Essential and desired qualifications as well as other relevant details for all the above positions are posted on the RGCB website (http://www.rgcb.res.in). The last date for receiving applications is March 14, 2014.

Sd/-
Director

Rajiv Gandhi Centre for Biotechnology
Thycaud, P.O., Poojappura,
Thiruvananthapuram, Kerala, India-695 014
Ph.: 91-471-2529400 (30 Lines), 2347975, 2348104, 2348753, 2345899
Fax: 91-471-2348096, 2346333

More at http://rgcb.res.in/jobs.html

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1