Address of the bookmark: https://bioinformatik.de/en/bioinformatics-in-germany/research/research-groups.html

Despite the degrees you’ve earned, the effort and passion you put in every day, the sacrifices you make – academia burdens you with tons of stressors. Financial, psychological, physical, and more.

We’re an unconventional team with backgrounds in various fields – both inside and outside of academia. And through our lens, it’s clear that academia deeply undervalues and underserves its very own community!

It’s time to reimagine research.

Address of the bookmark: https://researchrabbitapp.com/

Handle sequence locations for bioinformatics http://www.ingolia-lab.org/seqloc-tutorial.html

Address of the bookmark: http://www.stackage.org/snapshot/nightly-2014-12-28/package/seqloc-0.6

Bio-Linux is using an Ubuntu LTS version as its base

The fact that it uses Ubuntu LTS versions for the base is a good thing because it means its users won't have to worry about the support. Ubuntu 14.04 LTS is supported until 2019, so people who are using Bio-Linux shouldn't have a problem.

"An updated Bio-Linux 8 version is now on the website in ISO and OVA versions. As usual, there is no need to download this version if you are an existing user. All updates to existing packages will be applied to your system through the update manager and new packages are all available via apt-get or Synaptic," reads the announcement.

The changelog also states that a problem that was preventing the desktop to not start on VirtualBox has been fixed, the QIIME and Bowtie-Bio tools have been upgraded, the pandaseq paired end assembler has been added, and the beginners tutorial specific to Bio-Linux 8 has been improved.

Check out the official announcement for a complete list of changes and updates. You can download Bio-Linux 8.0.5 right now from Softpedia and give it a spin. It has the Unity desktop and now it runs very well in virtual environments.

Reference @ http://news.softpedia.com/news/Bioinformatics-Distro-Bio-Linux-8-0-5-Now-Available-for-Download-469867.shtml

If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

This is a short post giving steps on how to actually install R packages. Let’s suppose you want to install the ggplot2 package. Well nothing could be easier. We just fire up an R shell and type:

> install.packages("ggplot2")

In theory the package should just install, however:

• if you are using Linux and don’t have root access, this command won’t work.
• you will be asked to select your local mirror, i.e. which server should you use to download the package.

Installing packages without root access

First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory /data/Rpackages/ After creating a package directory, to install a package we use the command:

> install.packages("ggplot2", lib="/data/Rpackages/")
> library(ggplot2, lib.loc="/data/Rpackages/")


It’s a bit of a pain having to type /data/Rpackages/ all the time. To avoid this burden,  we create a file .Renviron in our home area, and add the line R_LIBS=/data/Rpackages/ to it. This means that whenever you start R, the directory /data/Rpackages/ is added to the list of places to look for R packages and so:

> install.packages("ggplot2")
> library(ggplot2)

just works!

Setting the repository

Every time you install a R package, you are asked which repository R should use. To set the repository and avoid having to specify this at every package install, simply:

• create a file .Rprofile in your home area.
• Add the following piece of code to it:


cat(".Rprofile: Setting UK repositoryn")
r = getOption("repos") # hard code the UK repo for CRAN
r["CRAN"] = "http://cran.uk.r-project.org"
options(repos = r)
rm(r)


I found this tip in a stackoverflow answer .

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl