<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28855?offset=1540</link>
	<atom:link href="https://bioinformaticsonline.com/related/28855?offset=1540" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5958/srfjrf-national-institute-of-immunology</guid>
  <pubDate>Wed, 30 Oct 2013 06:45:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF/JRF @ National Institute of Immunology]]></title>
  <description><![CDATA[
<p>ADVERTISEMENT OF WALK-IN-INTERVIEW</p>

<p>NAME OF THE POST : SRF/JRF (Four Posts only)</p>

<p>DURATION : Indicated with the respective project mentioned below:</p>

<p>NAME OF THE PROJECT : As Mentioned below:</p>

<p>1. Serological diversity and molecular characterization of Dichelobector nodusus and development of vaccine against virulent footroot funded by NAIP. (Tenable upto 31.03.2014)</p>

<p>2. Development of oral vaccine against Clostridium perfringenes employing translational fusion of immunodominant epitopes of beta toxin with heat labile entertoxin B funded by DBT. (Tenable upto 25.02.2014)</p>

<p>3. Indo-Norwegian project, “Evaluation of major porins, ompC and ompR of Areomonas hydrophila as potential vaccine candidates and identification and characterization of immune genes of Indian major carp, Labeo rohita” (Tenable upto 31.03.2014)</p>

<p>EDUCATIONAL QUALIFICATIONS: For JRF- M.Sc/M.Tech in any subject of Biological  Sciences/Life Sciences</p>

<p>For SRF- M.Sc/M.Tech in any subject of Biological Sciences/Life Sciences with 2 years of Research Experience.</p>

<p>JOB DESCRIPTION : The Candidate should have experience in gene Expression, protein purification, molecular biology techniques and bioinformatics<br />EMOLUMENTS : SRF: Rs. 18,000/- per month consolidated plus 30% HRA if /NET/GATE qualified otherwise Rs. 14,000/- per month consolidated + 30% HRA.</p>

<p>JRF: Rs. 16,000/- per month consolidated + 30% HRA if NET/GATE qualified otherwise Rs. 12,000/- per month consolidated + 30% HRA</p>

<p>SCIENTIST NAME : Dr. Lalit C. Garg, SS-VII (Gene Regulation Lab)</p>

<p>SCIENTIST’S EMAIL : lalit@nii.ac.in</p>

<p>WALK IN INTERVIEW ON : October 31st, 2013</p>

<p>REGISTRATION OF CANDIDATES: 10.30 AM to 11.00 AM </p>

<p>Advertisement: http://www1.nii.res.in/sites/default/files/project-Dr.Lalit-31oct2013.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6104/incob-2014</guid>
  <pubDate>Thu, 07 Nov 2013 17:53:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[InCoB 2014]]></title>
  <description><![CDATA[
<p>The 13th International Conference on Bioinformatics (InCoB 2014) will be held in Novotel Sydney Brighton Beach, Sydney, New South Wales, Australia. This year, the InCoB will be held earlier from 31st July to 2nd August 2014 to run back-to-back with the International Biophysics Congress 2014 at the Brisbane Convention and Exhibition Centre, Queensland (3-7 Aug).</p>

<p>More at http://incob2014.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/6300/list-of-bioinformatics-vacancy-jobs-opportunity-websites</guid>
	<pubDate>Tue, 12 Nov 2013 20:04:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/6300/list-of-bioinformatics-vacancy-jobs-opportunity-websites</link>
	<title><![CDATA[List of Bioinformatics Vacancy, Jobs, Opportunity websites]]></title>
	<description><![CDATA[<p>Bioinformatics cover wide area of biology, and indulge in almost all sort of science related work. Bioinformatician give strong emphasis on open access to biological information as well as Free and Open Source software!!</p>
<p>There are several jobs opening in bioinformatics all around the world, but many of them do not get proper attention due to lack of advertisements, or social connectivity. This bookmark is created for an academic, non-academic, scientists and budding researchers to help and updates the bioinformatics/computational biology jobs links of all know websites around the world.</p>
<p><strong>I also love to stream the live <strong>bioinformatics or Computational biology jobs</strong> updates using Twitter https://twitter.com/search?q=bioinformatics%20jobs&amp;src=typd</strong></p>
<p>Find out here about exciting job opportunities in the life sciences.</p>
<blockquote>
<p>Please add well known bioinformatics jobs websites below in comment section.</p>
</blockquote><p>Address of the bookmark: <a href="http://www.nature.com/naturejobs/science/jobs?utf8=%E2%9C%93&amp;q=bioinformatics&amp;where=&amp;commit=Find+Jobs" rel="nofollow">http://www.nature.com/naturejobs/science/jobs?utf8=%E2%9C%93&amp;q=bioinformatics&amp;where=&amp;commit=Find+Jobs</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6561/mathomics-lab</guid>
  <pubDate>Tue, 19 Nov 2013 18:17:32 -0600</pubDate>
  <link></link>
  <title><![CDATA[MATHomics Lab]]></title>
  <description><![CDATA[
<p>Mathomics is a collaborative research group of the Center for Mathematical Modeling and the Center for Genome Regulation at University of Chile, created to play a central role in the development of biotechnological projects, providing state of the art bioinformatics and mathematical modeling tools,  allowing to face these problems from the point of view of Systems Biology. </p>

<p>Lab page @ http://www.mathomics.cl/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6817/research-assistant-university-of-hyderabad</guid>
  <pubDate>Mon, 25 Nov 2013 10:21:26 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Assistant @ University of Hyderabad]]></title>
  <description><![CDATA[
<p>University of Hyderabad<br />Repository for Tomato Genomic Resources<br />Department of Plant Sciences<br />Bioinformatics Position in Tomato Functional Genomics </p>

<p>At the Repository for Tomato Genomics Resources, we are working on Tomato Functional Genomics, using TILLING, Insertional Mutagenesis, proteomics, metabolomics approaches to study fruit ripening in tomato. The current aims of the group include using reverse and forward genetics strategies to isolate tomato mutants delayed in ripening, having high lycopene and folate content in tomato fruits and analysis of light and hormonal signal transduction pathways. For recent publications of the group see (Plant Physiol 161: 2085–2101, Plant Physiol 156: 1424-1438; Molecular Plant 3: 854-869; Plant Methods 6: 3; Plant Methods 5:18; Plant Signaling and Behavior 5:11.).</p>

<p>Currently we have one position available in the projects awarded to Prof. R.P. Sharma funded by Dept of Biotechnology. The qualification for this Position is as follows:</p>

<p>Research Assistant: Applicants should have experience in networking using R language and should be able to develop networks using the transcriptome, proteome and metabolite data sets. M.Tech. in Bioinformatics is required. The selected candidate would be paid Rs. 13,000/-pm- consolidated.</p>

<p>Candidates interested in above positions should send a one page statement clearly explaining how their skills are relevant to the position. The candidates should also enclose detailed CV and the name/email id for three referees. The candidates can send their application by email at rameshwar.sharma@uohyd.ac.in and y.sreelakshmi@uohyd.ac.in on or before December 10th, 2013. The position is purely temporary in nature. Shortlisted candidates would be called for interview. No TA/DA would be provided for attending the interview. We also have openings for CSIR-NET JRF candidates for pursuing PhD in above research areas.</p>

<p>Interested candidates with CSIR-NET JRF can send their CV to the above email<br />addresses.</p>

<p>Advertisement:</p>

<p>http://www.uohyd.ac.in/images/recruitment/tomanet_positions_221113.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7816/boku-lab</guid>
  <pubDate>Wed, 08 Jan 2014 19:33:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[BOKU Lab]]></title>
  <description><![CDATA[
<p>We are interested in the study of complex systems in living organisms. Novel views augmenting the classical gene by gene approaches are required to overcome the engineered redundancies and combinatorial effects prevalent in higher eukaryotes. We therefore combine work to establish improved quantitative experimental assays, such as microarrays or differential in-gel electrophoresis, and development of modern computational methods, such as hierarchical probabilistic models or integration of heterogeneous data sources, focussed by biological studies in our laboratory and collaborations.</p>

<p>Highlights of our research include:</p>

<p>    Optimization of microarray design, probe signal interpretation <br />    Advanced models and tools for expression profiling<br />    State-of-the-art applications and integrated analyses </p>

<p>Lab page @ http://bioinf.boku.ac.at/</p>
]]></description>
</item>

</channel>
</rss>