<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28855?offset=840</link>
	<atom:link href="https://bioinformaticsonline.com/related/28855?offset=840" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22269/school-of-life-sciences-jawaharlal-nehru-university-vacancy-of-jrf-srf-ra-in-csir-funded-project</guid>
  <pubDate>Wed, 29 Apr 2015 21:26:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Project]]></title>
  <description><![CDATA[
<p>School of Life Sciences, Jawaharlal Nehru University has issued notification dated 27.04.2015 to fill the vacancy of JRF / SRF / RA in CSIR funded Projec entitled "Structural and functional characterization of serine biosynthetic pathway enzymes from entamoeba histolytica". It is good chance to get job with IITKGP and brighten your future. Learn eligibility criteria and apply on or before 08.05.2015.</p>

<p>Employer:	Jawaharlal Nehru University<br />Address:	Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067<br />Email:	not mentioned / provided for this job post<br />URL:	http://www.jnu.ac.in/Career/currentjobs.htm<br />Phone:	011 2674 2575<br />Skills:	not mentioned / required for this job post<br />Experience:	Experience in molecular biology, structural biology and bioinformatics is desired<br />Education:	M.Sc. in any field of life sciences.<br />Job Location:	New Delhi, Delhi, India   (View Jobs in New Delhi,   Jobs in Delhi,   Jobs in India)</p>

<p>Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec</p>

<p>Name of the Post: JRF / SRF / RA</p>

<p>Salary: As per rules</p>

<p>Required Job Profile:</p>

<p>Candidate must possess M.Sc. in any field of life sciences.</p>

<p>Desired Job Profile:</p>

<p>Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.</p>

<p>How to apply:</p>

<p>Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.</p>

<p>Refer to http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35386/list-of-visualization-tools-for-network-biology</guid>
	<pubDate>Mon, 29 Jan 2018 05:12:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35386/list-of-visualization-tools-for-network-biology</link>
	<title><![CDATA[List of visualization tools for network biology]]></title>
	<description><![CDATA[<p>Network analysis&nbsp;is any structured technique used to mathematically analyze a circuit (a &ldquo;network&rdquo; of interconnected components). The&nbsp;<span>Network analysis provides the ability to quantify associations between individuals, which makes it possible to infer details about the network as a whole at the species and/or population level.&nbsp;</span>Few tools published in BMC are listed here https://bmcbioinformatics.biomedcentral.com/articles/sections/networks-analysis.</p><p><img src="https://www.dropbox.com/pri/get/Public/Link%20to%20network.gif?_subject_uid=85115969&amp;raw=1&amp;revision_id=BBqs9eYx7G_faj5J33ExdjmtF8nXK2xrN5dUBsKyTLZQ9RB_hGM-YFmWZMBzbQZfRvjYzfs65HbQYrHRyoikxsQscSFTn1Nud2QeJ8KGfVI5wv4Kzp6froKOmPZu8ZygfKo&amp;size=1280x960&amp;size_mode=3&amp;w=AABQaErsFIz5ZjVZSxXvKaSVUkY5ob1Yjk0x7dghy0X7zw" alt="image" style="border: 0px; border: 0px;"></p><p>Following are the list of standalone applications for network analysis:</p><p>Arena 3D</p><p>3D visualization of multi-layer networks</p><p>http://www.arena3d.org</p><p>Biana</p><p>Data integration and network management</p><p>http://sbi.imim.es/web/BIANA.php</p><p>BioLayout Express 3D&nbsp;</p><p>2D/3D network visualization</p><p>http://www.biolayout.org/</p><p>BiologicalNetworks&nbsp;</p><p>Efficient integrated multi-level analysis of microarray, sequence, regulatory and other data</p><p>http://www.biologicalnetworks.org</p><p>BioMiner</p><p>Modeling, analyzing and visualizing biochemical pathways and networks</p><p>http://www.zbi.uni-saarland.de/chair/projects/BioMiner</p><p>Cell Illustrator&nbsp;</p><p>Petri nets for modeling and simulating biological networks</p><p>http://www.cellillustrator.com</p><p>COPASI</p><p>Analysis of biochemical networks and their dynamics</p><p>http://www.copasi.org/</p><p>Cytoscape&nbsp;</p><p>Network visualization and analysis. Over 200 plugins [60]</p><p>http://www.cytoscape.org/</p><p>Dizzy</p><p>Chemical kinetics stochastic simulation software</p><p>http://magnet.systemsbiology.net/software/Dizzy/</p><p>DyCoNet</p><p>Gephi plugin that can be used to identify dynamic communities in networks</p><p>https://github.com/juliemkauffman/DyCoNet</p><p>GENeVis&nbsp;</p><p>Network and pathway visualization</p><p>http://tinyurl.com/genevis/</p><p>GEPHI&nbsp;</p><p>Interactive visualization and exploration for any network and complex system, dynamic and hierarchical graph.</p><p>https://gephi.org</p><p>Igraph</p><p>Collection of network analysis tools with the emphasis on efficiency, portability and ease of use</p><p>http://igraph.sourceforge.net</p><p>Medusa</p><p>Semantic and multi-edged simple networks</p><p>https://sites.google.com/site/medusa3visualization/</p><p>NAViGaTOR</p><p>Visualizing and analyzing protein-protein interaction networks</p><p>http://tinyurl.com/navigator1/</p><p>N-Browse</p><p>Interactive graphical browser for biological networks</p><p>http://www.gnetbrowse.org/</p><p>NeAT</p><p>Topological and clustering analysis of networks</p><p>http://rsat.ulb.ac.be/neat/</p><p>Ondex&nbsp;</p><p>Data integration and visualization of large networks</p><p>http://www.ondex.org/</p><p>Osprey</p><p>Visualization and annotation of biological networks</p><p>http://biodata.mshri.on.ca/osprey/servlet/Index</p><p>Pajek&nbsp;</p><p>Analysis and visualization of large networks and social network analysis</p><p>http://vlado.fmf.uni-lj.si/pub/networks/pajek/</p><p>PathwayAssist&nbsp;</p><p>Navigation and analysis of biological pathways, gene regulation networks and protein interaction maps.</p><p>http://www.ariadnegenomics.com/downloads/</p><p>PIVOT&nbsp;</p><p>Layout algorithms for visualizing protein interactions and families</p><p>http://acgt.cs.tau.ac.il/pivot/</p><p>ProCope&nbsp;</p><p>Prediction and evaluation of protein complexes from purification data experiments</p><p>http://www.bio.ifi.lmu.de/Complexes/ProCope/</p><p>ProViz&nbsp;</p><p>Visualization and exploration of interaction networks. Gene Ontology and PSI-MI formats supported</p><p>http://cbi.labri.fr/eng/proviz.htm</p><p>SpectralNET&nbsp;</p><p>Network analysis and visualizations. Scatter plots and dimensionality reduction algorithms</p><p>https://www.broadinstitute.org/software/spectralnet</p><p>Tulip&nbsp;</p><p>Enables the development of algorithms, visual encodings, interaction techniques, data models and domain-specific visualizations</p><p>http://tulip.labri.fr/TulipDrupal/</p><p>VANESA&nbsp;</p><p>Automatic reconstruction and analysis of biological networks and Petri nets based on life-science database information</p><p>http://agbi.techfak.uni-bielefeld.de/vanesa/</p><p>VANTED&nbsp;</p><p>Network reconstruction, data visualization, integration of various data types, network simulation</p><p>http://tinyurl.com/vanted/</p><p>yEd</p><p>Creation of diagrams manually and import external data</p><p>http://tinyurl.com/yEdGraph/</p><p>Web tools for network analysis</p><p>APID&nbsp;</p><p>Unified protein-protein interactions from BIND, BioGRID, DIP, HPRD, IntAct and MINT</p><p>http://bioinfow.dep.usal.es/apid/</p><p>Arcadia&nbsp;</p><p>Translates text-based descriptions of biological networks (SBML files) into standardized diagrams (Systems Biology Graphical Notation Process Description maps)</p><p>http://arcadiapathways.sourceforge.net/</p><p>AVIS&nbsp;</p><p>Viewer for signaling networks</p><p>http://actin.pharm.mssm.edu/AVIS2</p><p>bioPIXIE&nbsp;</p><p>Discovery of biological networks from diverse functional genomic data</p><p>http://pixie.princeton.edu/pixie</p><p>CellPublisher</p><p>Interactive representations of biochemical processes</p><p>http://cellpublisher.gobics.de/</p><p>Graphle</p><p>Distributed network exploration and visualization of interactive large, dense graphs</p><p>http://tinyurl.com/graphle/</p><p>GraphWeb&nbsp;</p><p>Web server for graph-based analysis of biological networks</p><p>http://biit.cs.ut.ee/graphweb/</p><p>Hubba</p><p>Web-based service to explore the essential nodes in a network</p><p>http://hub.iis.sinica.edu.tw/Hubba</p><p>NetworkBLAST&nbsp;</p><p>Analysis of protein interaction networks across species to infer protein complexes that are conserved in evolution</p><p>http://www.cs.tau.ac.il/~bnet/networkblast.htm</p><p>Pathview&nbsp;</p><p>Tool set for pathway-based data integration and visualization</p><p>http://Pathview.r-forge.r-project.org/</p><p>PINA&nbsp;</p><p>Integrated platform for protein interaction network construction, filtering, analysis, visualization and management</p><p>http://cbg.garvan.unsw.edu.au/pina/home.do</p><p>ReMatch&nbsp;</p><p>Web-based tool for integration of user-given stoichiometric metabolic models into a database collected from public data sources</p><p>http://www.cs.helsinki.fi/group/sysfys/software/rematch/</p><p>SNOW&nbsp;</p><p>Gene mapping on a reference or human protein-protein interaction network that SNOW hosts</p><p>http://snow.bioinfo.cipf.es</p><p>STITCH&nbsp;</p><p>Resource to explore known and predicted interactions of chemicals and proteins</p><p>http://stitch.embl.de/</p><p>STRING</p><p>Protein interaction networks and integration of data such as genomic context, high-throughput experiments, conserved coexpression and previous knowledge derived from the literature</p><p>http://string-db.org</p><p>TVNViewer&nbsp;</p><p>An interactive visualization tool for exploring networks that change over time or space</p><p>http://www.sailing.cs.cmu.edu/main/?page_id=545</p><p>tYNA&nbsp;</p><p>System for managing, comparing and mining multiple networks</p><p>http://tyna.gersteinlab.org/tyna/</p><p>VisANT&nbsp;</p><p>Visualization, mining, analysis and modeling of biological networks, metabolic networks and ecosystems</p><p>http://visant.bu.edu/</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22287/research-fellows-at-aimscs-hyderabad</guid>
  <pubDate>Wed, 06 May 2015 06:23:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellows at AIMSCS, Hyderabad]]></title>
  <description><![CDATA[
<p>C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh<br />Advertisement No.: 5/2015</p>

<p>Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)</p>

<p>JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,</p>

<p>Pay Scale : Rs. 25,000</p>

<p>SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.</p>

<p>Pay Scale : Rs. 28,000*</p>

<p>No.of Post: 2</p>

<p>Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.</p>

<p>More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37584/mulan-multiple-sequence-local-alignment-and-visualization-for-studying-function-and-evolution</guid>
	<pubDate>Fri, 24 Aug 2018 09:50:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37584/mulan-multiple-sequence-local-alignment-and-visualization-for-studying-function-and-evolution</link>
	<title><![CDATA[Mulan: Multiple-sequence local alignment and visualization for studying function and evolution]]></title>
	<description><![CDATA[<p>Mulan: Multiple-sequence local alignment and visualization for studying function and evolution</p>
<p><span>Mulan (</span><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC540288/#ref44">http://mulan.dcode.org/</a><span>), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the TBA multi-aligner program for rapid identification of local sequence conservation, and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA.</span></p><p>Address of the bookmark: <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC540288/" rel="nofollow">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC540288/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/44284/tools-for-geospatial-data-analysis</guid>
	<pubDate>Wed, 22 Mar 2023 02:10:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/44284/tools-for-geospatial-data-analysis</link>
	<title><![CDATA[Tools for Geospatial data analysis !]]></title>
	<description><![CDATA[<div><div><div><div><div><div><div><div><div><div><p>Geospatial data is becoming increasingly important in many fields, including urban planning, environmental science, public health, and more. These tools can help you work with data from a variety of sources, including satellite imagery, GPS data, and other forms of spatial data. They can help you visualize data, perform complex analysis, and even create maps and other visualizations.</p><p>The list includes some of the most popular and widely used geospatial tools available in Python. These tools can help you work with data from a variety of sources and in a variety of formats. Some of the tools are focused on visualization, such as Cartopy, Folium, and Contextily, which allow you to create interactive maps and other visualizations. Other tools are more focused on data manipulation and analysis, such as Fiona, GeoPandas, and Rasterio, which allow you to manipulate and analyze spatial data in a variety of ways.</p><p>The list also includes some tools for working with specific types of geospatial data. For example, the H3 library is designed specifically for working with hexagonal grids, while PySAL is focused on spatial econometrics and spatial analysis. Whether you are a data scientist, GIS specialist, or geospatial enthusiast, these tools are sure to enhance your work and help you achieve your goals.</p><p>In summary, this list is an excellent resource for anyone working with geospatial data in Python. It contains a wide range of tools for working with different types of data, and can help you visualize data, perform complex analysis, and create maps and other visualizations. If you're looking to enhance your skills in geospatial analysis, this list is definitely worth checking out.</p></div></div></div><div><p>These tools are:</p><ul>
<li>ArcGIS - <a href="https://lnkd.in/dgC6sKJH" target="_new">https://lnkd.in/dgC6sKJH</a></li>
<li>Cartopy - <a href="https://lnkd.in/dc8ijXRg" target="_new">https://lnkd.in/dc8ijXRg</a></li>
<li>Contextily - <a href="https://lnkd.in/dTdQsmKX" target="_new">https://lnkd.in/dTdQsmKX</a></li>
<li>Descartes - <a href="https://lnkd.in/dCJykxwW" target="_new">https://lnkd.in/dCJykxwW</a></li>
<li>Fiona - <a href="https://lnkd.in/d8sJ3Q5a" target="_new">https://lnkd.in/d8sJ3Q5a</a></li>
<li>Folium - <a href="https://lnkd.in/dfSsE-MB" target="_new">https://lnkd.in/dfSsE-MB</a></li>
<li>GDAL - <a href="https://lnkd.in/dYBJBaAY" target="_new">https://lnkd.in/dYBJBaAY</a></li>
<li>Geohash - <a href="https://lnkd.in/d_NxJ4_M" target="_new">https://lnkd.in/d_NxJ4_M</a></li>
<li>GeoJSON - <a href="https://lnkd.in/daGs2WYq" target="_new">https://lnkd.in/daGs2WYq</a></li>
<li>GeoPandas - <a href="https://lnkd.in/dBTFKKV3" target="_new">https://lnkd.in/dBTFKKV3</a></li>
<li>Geopy - <a href="https://lnkd.in/dfAzR8Xa" target="_new">https://lnkd.in/dfAzR8Xa</a></li>
<li>Gevent - <a href="http://www.gevent.org/" target="_new">http://www.gevent.org</a></li>
<li>H3 - <a href="https://h3geo.org/docs/" target="_new">https://h3geo.org/docs/</a></li>
<li>OSMnx - <a href="https://lnkd.in/dm3pHgUS" target="_new">https://lnkd.in/dm3pHgUS</a></li>
<li>PyQGIS - <a href="https://lnkd.in/dShWyWVr" target="_new">https://lnkd.in/dShWyWVr</a></li>
<li>PySAL - <a href="https://pysal.org/" target="_new">https://pysal.org</a></li>
<li>Pydeck - <a href="https://lnkd.in/dGBFu-iw" target="_new">https://lnkd.in/dGBFu-iw</a></li>
<li>Pyproj - <a href="https://lnkd.in/dNG9fdkm" target="_new">https://lnkd.in/dNG9fdkm</a></li>
<li>RTree - <a href="https://lnkd.in/dURMiYpU" target="_new">https://lnkd.in/dURMiYpU</a></li>
<li>Rasterio - <a href="https://lnkd.in/dEMC6ve6" target="_new">https://lnkd.in/dEMC6ve6</a></li>
<li>Scikit-mobility - <a href="https://lnkd.in/dpHhaX2J" target="_new">https://lnkd.in/dpHhaX2J</a></li>
<li>Shapely - <a href="https://lnkd.in/d568datK" target="_new">https://lnkd.in/d568datK</a></li>
</ul><p>These tools offer a wide range of capabilities for working with geospatial data, from visualizing and manipulating data to performing complex analysis and modeling. Whether you are a data scientist, GIS specialist, or geospatial enthusiast, these tools are sure to enhance your work and help you achieve your goals.</p></div></div></div></div></div></div></div></div>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44655/ngenomesyn-an-easy-to-use-and-flexible-tool-for-publication-ready-visualization-of-syntenic-relationships-across-multiple-genomes</guid>
	<pubDate>Tue, 10 Sep 2024 04:54:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44655/ngenomesyn-an-easy-to-use-and-flexible-tool-for-publication-ready-visualization-of-syntenic-relationships-across-multiple-genomes</link>
	<title><![CDATA[NGenomeSyn: an easy-to-use and flexible tool for publication-ready visualization of syntenic relationships across multiple genomes]]></title>
	<description><![CDATA[<p>NGenomeSyn: an easy-to-use and flexible tool for publication-ready visualization of syntenic relationships across multiple genomes&nbsp;</p>
<p><img src="https://github.com/hewm2008/NGenomeSyn/raw/main/Example/example2/OUT3.png" alt="image" style="border: 0px;"></p>
<p><span>NGenomeSyn [multiple (N) Genome Synteny], for publication-ready visualization of syntenic relationships of the whole genome or local region and genomic features (e.g. repeats, structural variations, genes) across multiple genomes with a high customization. NGenomeSyn provides an easy way for its users to visualize a large amount of data with a rich layout by simply adjusting options for moving, scaling, and rotation of target genomes. Moreover, NGenomeSyn could be applied on the visualization of relationships on non-genomic data with similar input formats.</span></p>
<p>https://academic.oup.com/bioinformatics/article/39/3/btad121/7072460</p><p>Address of the bookmark: <a href="https://github.com/hewm2008/NGenomeSyn" rel="nofollow">https://github.com/hewm2008/NGenomeSyn</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>