<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28870?offset=1340</link>
	<atom:link href="https://bioinformaticsonline.com/related/28870?offset=1340" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5422/shendure-lab</guid>
  <pubDate>Wed, 09 Oct 2013 14:21:58 -0500</pubDate>
  <link></link>
  <title><![CDATA[Shendure Lab]]></title>
  <description><![CDATA[
<p>The Shendure Lab is part of the Department of Genome Sciences at the University of Washington (Seattle, WA). The mission of the lab is to develop and apply new technologies in genomics and molecular biology. Most projects in the lab exploit new DNA sequencing technologies (Shendure et al., Nature Reviews Genetics 2004; Shendure &amp; Ji, Nature Biotechnology 2008; Shendure &amp; Lieberman Aiden, Nature Biotechnology 2012), and generally fall into one of six areas: 1) next-generation human genetics; 2) genome contiguity &amp; completeness; 3) massively parallel functional analysis; 4) molecular tagging; 5) synthetic biology; 6) translational genomics. Our interests in each of these areas are outlined briefly below, and a full list of publications is available via PubMed. http://www.ncbi.nlm.nih.gov/pubmed?cmd=search&amp;term=shendure<br />More http://krishna.gs.washington.edu/research.html</p>

<p>Lab page @ http://krishna.gs.washington.edu/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5663/network-analysis-indian-statistical-institute</guid>
  <pubDate>Wed, 16 Oct 2013 08:06:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Network Analysis @ Indian Statistical Institute]]></title>
  <description><![CDATA[
<p>Indian Statistical Institute Kolkata invites applications for the following posts</p>

<p>2013 Oct Advertisement from Indian Statistical Institute</p>

<p>Post: Network Analysis</p>

<p>No. of Positions:  01</p>

<p>Educational Qualifications:</p>

<p>Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class<br />Experience:</p>

<p>(details of experience required)<br />Pay Scale: INR Rs.16000-20000/-P.M.</p>

<p>Walk-In-Interview : 22 Oct 2013 at 10:30 AM</p>

<p>Download Official Notification:<br />http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5748/troyanskaya-lab</guid>
  <pubDate>Fri, 18 Oct 2013 10:57:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Troyanskaya  Lab]]></title>
  <description><![CDATA[
<p>In our research, we combine computational methods with an experimental component in a unified effort to develop comprehensive descriptions of genetic systems of cellular controls, including those whose malfunctioning becomes the basis of genetic disorders, such as cancer, and others whose failure might produce developmental defects in model systems.</p>

<p>Research Interest<br />Genomic Data Integration</p>

<p>Microarray Analysis</p>

<p>Gene and Protein Function Prediction</p>

<p>Detection and Analysis of Chromosomal Abnormalities and Functional Evolution</p>

<p>Integration of Computation and Experiments</p>

<p>Identification of Biological Networks and Pathways</p>

<p>Evaluation and Validation of Computational Predictions</p>

<p>Scalable Visualization-Based Data Analysis</p>

<p>More @ http://reducio.princeton.edu/cm/<br />PI page @ http://reducio.princeton.edu/cm/ogt</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5957/assistant-professor-in-molecular-synthesis-for-drug-discovery-and-development-cbmr-lucknow</guid>
  <pubDate>Wed, 30 Oct 2013 06:42:27 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor in Molecular Synthesis for Drug Discovery and Development @ CBMR, Lucknow]]></title>
  <description><![CDATA[
<p>ADVERTISEMENT FOR FACULTY POSITIONS AT CENTRE OF BIOMEDICAL RESEARCH (CBMR), LUCKNOW</p>

<p>Details of the Positions and Pay Structure:</p>

<p>03 Posts for Assistant Professor in Molecular Synthesis for Drug Discovery and Development</p>

<p>Essential Qualifications and Requirements:</p>

<p>1. PhD in Synthetic Organic Chemistry/Medicinal Chemistry with research publications in high quality international journals and first class grade at the preceding degree from recognised University/Institute in India or abroad with consistently good academic record.<br />2. Three Yrs of Post-doctoral experience in relevant area.<br />3. Below 35 Yrs of age at the time of application</p>

<p>Desirable Experience: Candidates having strong research background in organic synthesis, total synthesis of structurally complex and medicinally important natural products/drugs related to cancer, neurodegenerative diseases (neurotropically active molecules for Alzheimer's, Parkinson’s, dementia etc) and infectious diseases such as malaria, TB etc. will be preferred.</p>

<p>Interested candidates may apply with:</p>

<p>1. Filled up Application Form (download from CBMR Website: http://www.cbmr.res.in) along with the Cover Letter, Curriculum Vitae including academic record (Bachelor degree onwards), awards, honours, list of Publications and reprints of 5 best publications.<br />2. Proposed research plan (max 3-4 pages).<br />3. Names and address (with valid e-mail and Phone number) of at least 3 academic referees.<br />4. Online Payment Receipt with transaction reference no. of Rs. 1000/- (USD 100 or equivalent foreign currency) on following details.<br />Account Number: 30054847814 Name: Director, Centre of Biomedical Research<br />Bank: STATE BANK OF INDIA, SGPGI Campus Branch, LUCKNOW</p>

<p>IFSC Code: SBIN0007789<br />MICR No: 22602034</p>

<p>Applications can be sent by registered/speed post or by e-mail to the following address:</p>

<p>The Director,<br />Centre of Biomedical Research (CBMR),<br />Sanjay Gandhi PGI Campus,<br />Raebareli Road, Lucknow-226014<br />e-mail: cbmr.admin@cbmr.res.in,<br />gp.pandey@cbmr.res.in</p>

<p>More Info:</p>

<p>http://www.cbmr.res.in/career/Advertisement%20for%20the%20post%20of%20Professors%20and%20Assistant%20Professors.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24041/junior-bioinformatic-position</guid>
  <pubDate>Wed, 26 Aug 2015 05:35:28 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Bioinformatic position]]></title>
  <description><![CDATA[
<p>Junior Bioinformatic position in the laboratory of Inflammation and immunology in cardiovascular pathologies at Humanitas:</p>

<p>We are seeking a highly motivated young PhD student with strong interest in high throughput data analysis.<br />Detailed descriptions of our recent research activities may be found here:<br />http://www.humanitas-research.org/condorelli-gianluigi-md-phd/</p>

<p>Position is available starting from October/November. A probationary period of one month will be required.<br /> <br />Please send a CV along with a cover letter stating the reasons for applying and contact details of one or more referees to Dr. Paolo Kunderfranco (paolo.kunderfranco@humanitasresearch.it).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>