<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28870?offset=1550</link>
	<atom:link href="https://bioinformaticsonline.com/related/28870?offset=1550" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5220/paolo-ruggerone-lab</guid>
  <pubDate>Tue, 01 Oct 2013 14:15:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[Paolo Ruggerone Lab]]></title>
  <description><![CDATA[
<p>Efflux pumps (RND family)</p>

<p>Functioning of efflux systems in Gram-negative bacteria<br />Determinants of the compound-efflux system interactions<br />Action of inhibitors on efflux systems<br />Structural and dynamical features of the efflux systems</p>

<p>TatA<br />Assembly of the TatA system<br />Study of the dynamical features of the charge zipper</p>

<p>Methods<br />Setup of a kinetic Monte Carlo (KMC) scheme to study the flux of antibiotics through porins and efflux systems<br />Setup of protocol to integrate MD results in a ligand-based approach</p>

<p>Viral inhibitors<br />Interactions of selected compounds with RNA-dependent RNA polymerases (RdRps) of HCV and BVDV<br />Assessment of the role of mutations in RdRps<br />Antimicrobial peptides</p>

<p>Interactions of antimicrobial peptides with membranes: structure and dynamics<br />Interactions between antimicrobial peptides in the presence of different membranes<br />Protein-protein interactions<br />Effects of mutations</p>

<p>Lab Page<br />http://www.dsf.unica.it/~paolo/Site/Home.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5310/bergman-lab</guid>
  <pubDate>Thu, 03 Oct 2013 17:20:09 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bergman Lab]]></title>
  <description><![CDATA[
<p>Broad area of research:</p>

<p>Genome Annotation and Functional Genomics</p>

<p>Bergman Lab is actively engaged in the development and application of computational methods to improve the annotation of functional biological features in genome sequences.  Bergman Lab work focuses on improving annotation of non-protein-coding regions of the genome including conserved noncoding sequences (CNSs), cis-regulatory modules (CRMs), transcription factor binding sites (TFBSs), transposable elements (TEs) and noncoding RNA (ncRNA) genes. Current projects include improving the (i) annotation of TEs in the fly and yeast genomes, (ii) annotation of CRMs and TFBSs in the fly genome, and (iii) analysis of transposon knockout collections in flies. Research in this area is supported by the EC FP7 programme.</p>

<p>Genome and Molecular Evolution<br />Text and Data Mining</p>

<p>More @ http://bergmanlab.smith.man.ac.uk/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/5436/the-anatomy-of-successful-computational-biology-software</guid>
	<pubDate>Thu, 10 Oct 2013 11:53:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/5436/the-anatomy-of-successful-computational-biology-software</link>
	<title><![CDATA[The anatomy of successful computational biology software]]></title>
	<description><![CDATA[<p>Creators of software widely used in computational biology discuss the factors that contributed to their success</p><p><em>Nature Biotechnology</em><span>&nbsp;spoke with Altschul and several other originators of computational biology software programs widely used today (</span><a href="http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html#t1">Table 1</a><span>). The conversations explored what makes certain software tools successful, the unique challenges of developing them for biological research and how the field of computational biology, as a whole, can move research agendas forward. What follows is an edited compilation of interviews.</span></p><p>Detail @&nbsp;<a href="http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html">http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html</a></p><p>News Source @ Nature</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5663/network-analysis-indian-statistical-institute</guid>
  <pubDate>Wed, 16 Oct 2013 08:06:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Network Analysis @ Indian Statistical Institute]]></title>
  <description><![CDATA[
<p>Indian Statistical Institute Kolkata invites applications for the following posts</p>

<p>2013 Oct Advertisement from Indian Statistical Institute</p>

<p>Post: Network Analysis</p>

<p>No. of Positions:  01</p>

<p>Educational Qualifications:</p>

<p>Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class<br />Experience:</p>

<p>(details of experience required)<br />Pay Scale: INR Rs.16000-20000/-P.M.</p>

<p>Walk-In-Interview : 22 Oct 2013 at 10:30 AM</p>

<p>Download Official Notification:<br />http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5748/troyanskaya-lab</guid>
  <pubDate>Fri, 18 Oct 2013 10:57:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Troyanskaya  Lab]]></title>
  <description><![CDATA[
<p>In our research, we combine computational methods with an experimental component in a unified effort to develop comprehensive descriptions of genetic systems of cellular controls, including those whose malfunctioning becomes the basis of genetic disorders, such as cancer, and others whose failure might produce developmental defects in model systems.</p>

<p>Research Interest<br />Genomic Data Integration</p>

<p>Microarray Analysis</p>

<p>Gene and Protein Function Prediction</p>

<p>Detection and Analysis of Chromosomal Abnormalities and Functional Evolution</p>

<p>Integration of Computation and Experiments</p>

<p>Identification of Biological Networks and Pathways</p>

<p>Evaluation and Validation of Computational Predictions</p>

<p>Scalable Visualization-Based Data Analysis</p>

<p>More @ http://reducio.princeton.edu/cm/<br />PI page @ http://reducio.princeton.edu/cm/ogt</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5957/assistant-professor-in-molecular-synthesis-for-drug-discovery-and-development-cbmr-lucknow</guid>
  <pubDate>Wed, 30 Oct 2013 06:42:27 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor in Molecular Synthesis for Drug Discovery and Development @ CBMR, Lucknow]]></title>
  <description><![CDATA[
<p>ADVERTISEMENT FOR FACULTY POSITIONS AT CENTRE OF BIOMEDICAL RESEARCH (CBMR), LUCKNOW</p>

<p>Details of the Positions and Pay Structure:</p>

<p>03 Posts for Assistant Professor in Molecular Synthesis for Drug Discovery and Development</p>

<p>Essential Qualifications and Requirements:</p>

<p>1. PhD in Synthetic Organic Chemistry/Medicinal Chemistry with research publications in high quality international journals and first class grade at the preceding degree from recognised University/Institute in India or abroad with consistently good academic record.<br />2. Three Yrs of Post-doctoral experience in relevant area.<br />3. Below 35 Yrs of age at the time of application</p>

<p>Desirable Experience: Candidates having strong research background in organic synthesis, total synthesis of structurally complex and medicinally important natural products/drugs related to cancer, neurodegenerative diseases (neurotropically active molecules for Alzheimer's, Parkinson’s, dementia etc) and infectious diseases such as malaria, TB etc. will be preferred.</p>

<p>Interested candidates may apply with:</p>

<p>1. Filled up Application Form (download from CBMR Website: http://www.cbmr.res.in) along with the Cover Letter, Curriculum Vitae including academic record (Bachelor degree onwards), awards, honours, list of Publications and reprints of 5 best publications.<br />2. Proposed research plan (max 3-4 pages).<br />3. Names and address (with valid e-mail and Phone number) of at least 3 academic referees.<br />4. Online Payment Receipt with transaction reference no. of Rs. 1000/- (USD 100 or equivalent foreign currency) on following details.<br />Account Number: 30054847814 Name: Director, Centre of Biomedical Research<br />Bank: STATE BANK OF INDIA, SGPGI Campus Branch, LUCKNOW</p>

<p>IFSC Code: SBIN0007789<br />MICR No: 22602034</p>

<p>Applications can be sent by registered/speed post or by e-mail to the following address:</p>

<p>The Director,<br />Centre of Biomedical Research (CBMR),<br />Sanjay Gandhi PGI Campus,<br />Raebareli Road, Lucknow-226014<br />e-mail: cbmr.admin@cbmr.res.in,<br />gp.pandey@cbmr.res.in</p>

<p>More Info:</p>

<p>http://www.cbmr.res.in/career/Advertisement%20for%20the%20post%20of%20Professors%20and%20Assistant%20Professors.pdf</p>
]]></description>
</item>

</channel>
</rss>