➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Applications are invited for the posts of one Junior Research Fellow in the DBT funded project entitled “Plant parasitic nematode genome informatics - insilico resource development”. The project is for a period of three years.

Essential qualifications for JRF: First class M. Sc. / M. Tech in Bioinformatics. Knowledge of programming language, pearl, Statistics and database – HTML, CSS, Java script.

Desirable qualifications: Experience in handling next generation sequencing data

Age limit: 35 years maximum (5 year relaxation for SC/ST and women candidates) Emoluments: 16,000 + 30% HRA.

The post is purely temporary in nature and is co-terminus with the project. The appointment would be initially for one year and may be extended further upon satisfactory performance.

Those who are interested in pursuing Ph.D with strong research aptitude are preferred.

Interested candidates may attend the Walk in interview on 25th March 2014 along with the duly filled application forms (format in the following page) with all the relevant documents.

Venue: Division of Nematology, Indian Agricultural Research Institute, New Delhi 110012 (Room No. 306, 3rd floor, LBS building)

Reporting Time: Interested candidates should report strictly between 10.00 to 10.30 AM.

Interview time: 10.30 AM

Short-listed candidates will be called for interview at New Delhi. However, no TA and DA will be paid for attending the interview.

Advertisement:

https://www.iari.res.in/files/JRF_Nema-07032014-20140307-170017.pdf

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

is a state-funded virtual research center aimed at promoting imaging and informatics research infrastructure in South Dakota. BioSNTR research foci include analysis of large-scale genomics and imaging data, application of novel microscopy technologies to study signaling pathways, and identification of new compounds to manipulate signaling pathways.
Responsibilities: This person will be part of Plant Science team with research focus in bioinformatic and molecular network analyses of high throughput data (transcriptomic, proteomic, metabolomics, miRNA). The individual will be integrated into functional genomic projects encompassing grapevine dormancy and freezing tolerance (Fennell) and regulation of soybean nodulation (Subramanian). The successful candidate will perform computational analysis of high throughput, next-generation sequence data and possess the ability to use bioinformatics analytical tools on HPC clusters.

Required Qualifications:
• Ph.D. in plant computational biology or bioinformatics.
• Experience in a high performance computing environment.
• Perl, Python and Java programming experience
• Data management and database development experience

Desired Qualifications:
• Parallel computing experience
• Experience working in a multidisciplinary environment

Contact Information
South Dakota State University
Plant Science
Anne Fennell
anne.fennell@sdstate.edu
Tel. Number: 605-688-6373
http://www.biosntr.org

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser

In our day to day research activity, we need to securely copy our data from several to local computer and visa-versa. I am jotting down some of the commonly used SCP command for your future help. Hope you all will like it

What is Secure Copy?

scp allows files to be copied to, from, or between different hosts. It uses ssh for data transfer and provides the same authentication and same level of security as ssh.

Examples

Copy the file "gene.txt" from a remote host to the local host

    $ scp your_username@remotehost.edu:gene.txt /some/local/directory

Copy the file "foobar.txt" from the local host to a remote host

    $ scp gene.txt your_username@remotehost.edu:/some/remote/directory

Copy the directory "chromosome" from the local host to a remote host's directory "bar"

    $ scp -r chromosome your_username@remotehost.edu:/some/remote/directory/bar

Copy the file "gene.txt" from remote host "rh1.edu" to remote host "rh2.edu"

    $ scp your_username@rh1.edu:/some/remote/directory/gene.txt \
    your_username@rh2.edu:/some/remote/directory/

Copying the files "gene.txt" and "cancer.txt" from the local host to your home directory on the remote host

    $ scp gene.txt cancer.txt your_username@remotehost.edu:~

Copy the file "gene.txt" from the local host to a remote host using port 2264

    $ scp -P 2264 gene.txt your_username@remotehost.edu:/some/remote/directory

Copy multiple files from the remote host to your current directory on the local host

    $ scp your_username@remotehost.edu:/some/remote/directory/\{a,b,c\} .

    $ scp your_username@remotehost.edu:~/\{gene.txt,cancer.txt\} .

scp Performance

By default scp uses the Triple-DES cipher to encrypt the data being sent. Using the Blowfish cipher has been shown to increase speed. This can be done by using option -c blowfish in the command line.

    $ scp -c blowfish some_file your_username@remotehost.edu:~

It is often suggested that the -C option for compression should also be used to increase speed. The effect of compression, however, will only significantly increase speed if your connection is very slow. Otherwise it may just be adding extra burden to the CPU. An example of using blowfish and compression:

    $ scp -c blowfish -C local_file your_username@remotehost.edu:~

Address of the bookmark: https://github.com/rhysf/Synima

(A) Senior Research Fellow (One Post): Emoluments as per DST/DBT norms.

Candidates having M.Sc. degree (with minimum of 55% marks) or equivalent in Life Sciences/Biotechnology/Bioinformatics/ Molecular Biology or any other related field with minimum of two years of post M.Sc. research experience are eligible to apply. The candidate having computer skill (Linux, Perl, Java, MySQL) and/or experience in advanced molecular biology, next generation sequencing data analysis and molecular markers analysis will be preferred.

The position is completely on temporary basis and co-terminus with the project. The initial appointment will be for one year, which can be curtailed/extended on the basis of assessment of the candidate’s performance and discretion of the Competent Authority. NIPGR reserves the right to select the candidate against the above posts depending upon the qualifications and experience of the candidates. Reservation of posts shall be as per Govt. of India norms.

Eligible candidates may apply by sending hard copy of completed application in the given format with a cover letter showing interest and attested copies of the certificates and proof of research experience. The applications should reach at the address given below within 15 days from the date of the advertisement. The subject line on envelope must be superscribed by “Application for the Post of SRF in DST - AISRF project”.

Note: ONLY hard copy of the application in the given format will be accepted.

Last date April 03, 2014

Dr. Mukesh Jain
Staff Scientist
National Institute of Plant Genome Research
Aruna Asaf Ali Marg, P.O. Box NO. 10531,
New Delhi - 110067

Advertisement: http://www.nipgr.res.in/careers/vacancies_latest.php#

https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454

Address of the bookmark: http://ani.mypathogen.cn/

The interview will now be held 01st April 2014. The monthly fellowship of JRF will be Rs 12,000/- plus HRA as per the University rules.

Essential Qualification: Master degree in any discipline of Life Science with NET qualified or valid GATE score.

Desirable Qualification: Preference will be given to candidates having research experience in Bioinformatics.

The interested candidates should report for the Interview on 01st April, 2014 at 10:00 am in the Conference Room of Dean, School of Biotechnology, First floor, Gautam Buddha University, Greater Noida. Interested candidates may also send their resume to undersigned by postmail/e-mail shaktis@gbu.ac.in or shaktisahi@gmail.com. No TA and DA will be paid for appearing for the interview.

Dr. Shakti Sahi
(Principle Investigator)
School of Biotechnology
Gautam Buddha University
Greater Noida
Ph:9971791897

Advertisement:

www.gbu.ac.in/Recruitment/JRF_advertisement_DSTProject_Shakti_26March14.pdf