<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28906?offset=850</link>
	<atom:link href="https://bioinformaticsonline.com/related/28906?offset=850" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8174/the-2014-cemm-phd-program</guid>
  <pubDate>Wed, 05 Feb 2014 06:03:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[The 2014 CeMM PhD Program]]></title>
  <description><![CDATA[
<p>For our next PhD Program starting in October 2014 we are looking for exceptionally motivated PhD candidates with a keen interest in genomics and medicine and a strong interest to work in teams.</p>

<p>The 2014 CeMM PhD Program will focus on two thematic areas: INFECTION and CANCER, that are built on the pillars of epigenetics, bioinformatics and systems biology, chemical biology and the mechanism of action of drugs, high-throughput genetics, genomics and proteomics, and molecular and cell biology.</p>

<p>The choice of this strategic focus rests on the synergies between immunology, infection and cancer in pathophysiological and technological terms. It furthermore reflects the strength of the current CeMM faculty, itself built around the historical and contemporary expertise in immunology and cancer of the Medical University of Vienna.</p>

<p>As a CeMM PhD student you will get the chance to work at the cutting edge of interdisciplinary molecular medicine research and be trained by the entire CeMM and associated faculty to become one of the scientists shaping the future of molecular medicine.<br />Requirements</p>

<p>To be eligible to enroll in the CeMM PhD Program all candidates are required to have a bachelor’s or master’s degree in medicine, biology, chemistry, bioinformatics, mathematics or any scientific/technical, subject-relevant degree. Candidates do not need to have completed their degree at the time of application, however they must have obtained their final degree certificate by mid-September. The working language at CeMM is English, so excellent written and oral communication skills in English are required.<br />Timeline</p>

<p>    Applications open on 20th January and close on 20th March 2014.<br />    Two references are required to be submitted through the online system by 31st March 2014.<br />    All complete candidate applications are reviewed by the CeMM Faculty in early April.<br />    Selected candidates are invited to a Skype panel interview in late April.<br />    Shortlisted candidates are then invited to Vienna in May for a full interview process, including an opportunity to introduce yourself through a presentation and interview rounds, meet research group members, and attend an informal dinner to get to know the Faculty members and learn more about their research.<br />    Positions are offered by CeMM Faculty in June.<br />    Start of PhD Program: 1st October 2014 .</p>

<p>Contact</p>

<p>Binia Maria Günther, BEd BA<br />Human Resources Manager<br />bguenther@cemm.oeaw.ac.at</p>

<p>Catherine Lloyd, Ph.D.<br />PhD and Postdoc Program Manager<br />clloyd@cemm.oeaw.ac.at</p>

<p>More Info: www.cemm.oeaw.ac.at/phd-program/application/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8123/jrf-manit</guid>
  <pubDate>Sun, 02 Feb 2014 03:07:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ MANIT]]></title>
  <description><![CDATA[
<p>MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY BHOPAL</p>

<p>No. CSE/14/1038</p>

<p>Walk in Interview for the post of JRF under TEQIP-II</p>

<p>SN Department – Qualification Post Graduation – Time</p>

<p>1 Bio-Informatics &amp; Mathematics M.Tech Bio-informatics/M.Sc.* Maths  10.00 AM</p>

<p>2 Biological Sciences M.Sc.* in any branch of Biological Sciences 10.30 AM</p>

<p>3 Chemical Engineering M.Tech Chemical Engineering 11.00 AM</p>

<p>4 Chemistry M.Sc.* Chemistry 11.30 AM</p>

<p>5 Civil Engineering M.Tech Structure/GeoTech. /Water -Resources/Hydraulics/Environment/Transport 12.00 Noon</p>

<p>6 GIS M.Tech GIS/Civil 12.30 PM</p>

<p>7 Computer Science &amp; Engineering M.Tech CSE/Information Security 01.00 PM</p>

<p>8 Electrical Engineering M.Tech Electrical Derives 01.30 PM</p>

<p>9 Electronics &amp; Communication M.Tech Digital Communication 02.00 PM</p>

<p>10 MSME M.Tech Material Science/ Mechanical/Metallurgy 02.30 PM</p>

<p>11 Physics M.Sc.* Physics 03.00 PM</p>

<p>* M.Sc. with NET/GATE qualified</p>

<p>Resume along with one passport size photograph and relevant documents are required at the time of interview</p>

<p>Amount of Fellowship: Rs 18000/-month+ HRA</p>

<p>Duration: 31st Dec 2014 (End of TEQIP-II project)</p>

<p>Date of Interview: 7th  February 2014</p>

<p>Venue Institute Committee Room</p>

<p>Advertisement:</p>

<p>http://www.manit.ac.in/manitbhopal/Year2014/Recruitment/Advertisement%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8287/post-doc-in-computational-genetics-and-genomics-at-ceinge-biotecnologie-avanzate-naples-italy</guid>
  <pubDate>Tue, 11 Feb 2014 08:06:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post doc in Computational Genetics and Genomics at CEINGE Biotecnologie Avanzate, Naples, Italy]]></title>
  <description><![CDATA[
<p>We are seeking one motivated scientist to analyze genomics and transcriptomics data of a large collection of neuroblastoma tumors. The successful candidate will be part of a team of researchers with extensive expertise in genome cancer study. He/she will be involved in the analysis of DNA-seq, RNA-seq, ChIP-seq data using available methods running in R and UNIX environment.</p>

<p>Qualifications</p>

<p>PhD or Post-Graduated Master degree is required. Successful candidates will have some expertise in data analysis of NGS data by using methods running in R and UNIX environment. Familiarity with genome databases and browsers is required.</p>

<p>Application</p>

<p>Candidates should send a CV and a brief personal statement focusing on their skills and interests related to the research project.</p>

<p>Contacts</p>

<p>Start date: 1° April 2014<br />Salary on grant: 25,000 euros per year.<br />Contact Person (Referent): Mario Capasso<br />Ref. Email: mario.capasso@unina.it and achille.iolascon@unina.it<br />Tel: +39 081 3737889</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</guid>
	<pubDate>Thu, 13 Feb 2014 09:07:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</link>
	<title><![CDATA[New version of Modeller, 9.13]]></title>
	<description><![CDATA[<p>The new version of Modeller, 9.13, is now available for download! Please see the download page at <a href="http://www.facebook.com/l.php?u=http%3A%2F%2Fsalilab.org%2Fmodeller%2F&amp;h=mAQG5wo_Z&amp;enc=AZOoq2B7BxT95AT3Mw3za3VlbmRFke43YMI5vAjCAbBlIcf3bptn8pmFC1Idxrssy98117S03IgdcNmEWcQBi9bmi8Or_ut1D1yybt1ZonvPoCT3_LOglcYV7o6bEaa442_6LhbjefEaelkq0aq6dl0w&amp;s=1" target="_blank">http://salilab.org/modeller/</a> for more information.</p><p><img src="http://salilab.org/modeller/gifs/modeller.jpg" alt="image" width="848" height="272" style="border: 0px; border: 0px;"><br /> <br /> If you have a license key for Modeller 8 or 9, there is no need to reregister for Modeller 9.13 - the same license key will work. (It won't <span>do any harm to reregister if you want to, though!)<br /> <br /> 9.13 is primarily a bugfix release relative to the last public release(9.12). Major user-visible changes include:<br /> <br /> # Modeller now includes a variety of SOAP (statistically optimized atomic potential) scores for assessing proteins, loops, and interfaces.<br /> <br /> # The Lennard-Jones interaction energy is now artificially truncated at very short distance; this makes simulations with poor starting conditions much less likely to 'blow up'.<br /> <br /> # model.get_insertions(), model.get_deletions() and model.loops() now have an include_termini option; if False, residue ranges that include chain termini are excluded from the output.<br /> <br /> See the Modeller manual for a full change log: <a href="http://salilab.org/modeller/9.13/manual/node39.html" target="_blank">http://salilab.org/modeller/9.13/manual/node39.html</a><br /> <br /> If you encounter bugs in Modeller 9.13, please see <a href="http://salilab.org/modeller/9.13/manual/node10.html" target="_blank">http://salilab.org/modeller/9.13/manual/node10.html</a> for information on how to report them.</span></p><p><span>Reference:</span></p><p><span>http://salilab.org/modeller/</span></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</guid>
	<pubDate>Wed, 26 Feb 2014 17:50:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</link>
	<title><![CDATA[The Best Bioinformatics / Computational Biology Quotes]]></title>
	<description><![CDATA[<p><img src="http://bioinformaticsonline.com/mod//photo/hahaha.png" style="border: 0; border: 0px;" alt="image"></p><p>Bioinformatician are not anti-social; We are just genome friendly.</p><p>Bioinformatician would love to change the biological world, but they won't give us the genetic code :P</p><p>If at first you don't succeed; call it version 1.0</p><p>The glass is neither half-full nor half-empty: it's actually have several genomes.</p><p>I'm BioGeek.</p><p>Fedup with LIPS, try God script.</p><p>Idiot, Go ahead, make my data!</p><p>Thank god, my genome just compiled.</p><p>Error message: "Out of space on genome drive:"</p><p>Shut up mobile elements, or i'll flush you out.</p><p>Never underestimate the internet bandwidth, u gotta incomplete.</p><p>Applied fuzzy logic to understand God's logic?</p><p>Warning! Overflow, delete chromosome !</p><p>Be nice to the BioGeek, for all you know they might be the next curator!</p><p>Beware of computational biologist they screw genes and protein.</p><p>Warning! Your genome is full of garbage, delete it !</p><p>Bad or missing mouse genome. Spank the cat? (Y/N)</p><p>Genome make very fast, very accurate mistakes.</p><p>Let's BLAST it.</p><p>Some genome never has transposons. It just develops random features.</p><p>Go watch CINEMA and have BLAST.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>