<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28915?offset=820</link>
	<atom:link href="https://bioinformaticsonline.com/related/28915?offset=820" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8123/jrf-manit</guid>
  <pubDate>Sun, 02 Feb 2014 03:07:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ MANIT]]></title>
  <description><![CDATA[
<p>MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY BHOPAL</p>

<p>No. CSE/14/1038</p>

<p>Walk in Interview for the post of JRF under TEQIP-II</p>

<p>SN Department – Qualification Post Graduation – Time</p>

<p>1 Bio-Informatics &amp; Mathematics M.Tech Bio-informatics/M.Sc.* Maths  10.00 AM</p>

<p>2 Biological Sciences M.Sc.* in any branch of Biological Sciences 10.30 AM</p>

<p>3 Chemical Engineering M.Tech Chemical Engineering 11.00 AM</p>

<p>4 Chemistry M.Sc.* Chemistry 11.30 AM</p>

<p>5 Civil Engineering M.Tech Structure/GeoTech. /Water -Resources/Hydraulics/Environment/Transport 12.00 Noon</p>

<p>6 GIS M.Tech GIS/Civil 12.30 PM</p>

<p>7 Computer Science &amp; Engineering M.Tech CSE/Information Security 01.00 PM</p>

<p>8 Electrical Engineering M.Tech Electrical Derives 01.30 PM</p>

<p>9 Electronics &amp; Communication M.Tech Digital Communication 02.00 PM</p>

<p>10 MSME M.Tech Material Science/ Mechanical/Metallurgy 02.30 PM</p>

<p>11 Physics M.Sc.* Physics 03.00 PM</p>

<p>* M.Sc. with NET/GATE qualified</p>

<p>Resume along with one passport size photograph and relevant documents are required at the time of interview</p>

<p>Amount of Fellowship: Rs 18000/-month+ HRA</p>

<p>Duration: 31st Dec 2014 (End of TEQIP-II project)</p>

<p>Date of Interview: 7th  February 2014</p>

<p>Venue Institute Committee Room</p>

<p>Advertisement:</p>

<p>http://www.manit.ac.in/manitbhopal/Year2014/Recruitment/Advertisement%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8287/post-doc-in-computational-genetics-and-genomics-at-ceinge-biotecnologie-avanzate-naples-italy</guid>
  <pubDate>Tue, 11 Feb 2014 08:06:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post doc in Computational Genetics and Genomics at CEINGE Biotecnologie Avanzate, Naples, Italy]]></title>
  <description><![CDATA[
<p>We are seeking one motivated scientist to analyze genomics and transcriptomics data of a large collection of neuroblastoma tumors. The successful candidate will be part of a team of researchers with extensive expertise in genome cancer study. He/she will be involved in the analysis of DNA-seq, RNA-seq, ChIP-seq data using available methods running in R and UNIX environment.</p>

<p>Qualifications</p>

<p>PhD or Post-Graduated Master degree is required. Successful candidates will have some expertise in data analysis of NGS data by using methods running in R and UNIX environment. Familiarity with genome databases and browsers is required.</p>

<p>Application</p>

<p>Candidates should send a CV and a brief personal statement focusing on their skills and interests related to the research project.</p>

<p>Contacts</p>

<p>Start date: 1° April 2014<br />Salary on grant: 25,000 euros per year.<br />Contact Person (Referent): Mario Capasso<br />Ref. Email: mario.capasso@unina.it and achille.iolascon@unina.it<br />Tel: +39 081 3737889</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</guid>
	<pubDate>Thu, 13 Feb 2014 09:07:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8317/new-version-of-modeller-913</link>
	<title><![CDATA[New version of Modeller, 9.13]]></title>
	<description><![CDATA[<p>The new version of Modeller, 9.13, is now available for download! Please see the download page at <a href="http://www.facebook.com/l.php?u=http%3A%2F%2Fsalilab.org%2Fmodeller%2F&amp;h=mAQG5wo_Z&amp;enc=AZOoq2B7BxT95AT3Mw3za3VlbmRFke43YMI5vAjCAbBlIcf3bptn8pmFC1Idxrssy98117S03IgdcNmEWcQBi9bmi8Or_ut1D1yybt1ZonvPoCT3_LOglcYV7o6bEaa442_6LhbjefEaelkq0aq6dl0w&amp;s=1" target="_blank">http://salilab.org/modeller/</a> for more information.</p><p><img src="http://salilab.org/modeller/gifs/modeller.jpg" alt="image" width="848" height="272" style="border: 0px; border: 0px;"><br /> <br /> If you have a license key for Modeller 8 or 9, there is no need to reregister for Modeller 9.13 - the same license key will work. (It won't <span>do any harm to reregister if you want to, though!)<br /> <br /> 9.13 is primarily a bugfix release relative to the last public release(9.12). Major user-visible changes include:<br /> <br /> # Modeller now includes a variety of SOAP (statistically optimized atomic potential) scores for assessing proteins, loops, and interfaces.<br /> <br /> # The Lennard-Jones interaction energy is now artificially truncated at very short distance; this makes simulations with poor starting conditions much less likely to 'blow up'.<br /> <br /> # model.get_insertions(), model.get_deletions() and model.loops() now have an include_termini option; if False, residue ranges that include chain termini are excluded from the output.<br /> <br /> See the Modeller manual for a full change log: <a href="http://salilab.org/modeller/9.13/manual/node39.html" target="_blank">http://salilab.org/modeller/9.13/manual/node39.html</a><br /> <br /> If you encounter bugs in Modeller 9.13, please see <a href="http://salilab.org/modeller/9.13/manual/node10.html" target="_blank">http://salilab.org/modeller/9.13/manual/node10.html</a> for information on how to report them.</span></p><p><span>Reference:</span></p><p><span>http://salilab.org/modeller/</span></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</guid>
	<pubDate>Wed, 26 Feb 2014 17:50:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</link>
	<title><![CDATA[The Best Bioinformatics / Computational Biology Quotes]]></title>
	<description><![CDATA[<p><img src="http://bioinformaticsonline.com/mod//photo/hahaha.png" style="border: 0; border: 0px;" alt="image"></p><p>Bioinformatician are not anti-social; We are just genome friendly.</p><p>Bioinformatician would love to change the biological world, but they won't give us the genetic code :P</p><p>If at first you don't succeed; call it version 1.0</p><p>The glass is neither half-full nor half-empty: it's actually have several genomes.</p><p>I'm BioGeek.</p><p>Fedup with LIPS, try God script.</p><p>Idiot, Go ahead, make my data!</p><p>Thank god, my genome just compiled.</p><p>Error message: "Out of space on genome drive:"</p><p>Shut up mobile elements, or i'll flush you out.</p><p>Never underestimate the internet bandwidth, u gotta incomplete.</p><p>Applied fuzzy logic to understand God's logic?</p><p>Warning! Overflow, delete chromosome !</p><p>Be nice to the BioGeek, for all you know they might be the next curator!</p><p>Beware of computational biologist they screw genes and protein.</p><p>Warning! Your genome is full of garbage, delete it !</p><p>Bad or missing mouse genome. Spank the cat? (Y/N)</p><p>Genome make very fast, very accurate mistakes.</p><p>Let's BLAST it.</p><p>Some genome never has transposons. It just develops random features.</p><p>Go watch CINEMA and have BLAST.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</guid>
	<pubDate>Wed, 12 Mar 2014 13:41:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</link>
	<title><![CDATA[The DNA of a Successful Bioinformatician decoded !!!]]></title>
	<description><![CDATA[<p>Many blogs exist about successful bioinformatician, but this blog so far now is my personal view on characteristics of successful bioinformatician or computational biologist. &nbsp;Hmm &hellip; of course these views are subjective to my own personal experiences and therefore I don't claim that the view listed here is complete. As a human, I don&rsquo;t take them too serious. The success must not be the only target of your work. The target is to work on your own virtues; some of those virtues are the topic of this blog.</p><p><img src="http://bioinformaticsonline.com/mod/photo/genome_decode.png" alt="image" width="509" height="458" style="border: 0px; border: 0px;"><br /> <br /> <strong>1. Update new things continuously<br /></strong>As per my personal experience, it&rsquo;s not always easy to work as a bioinformatician! &nbsp;There are couple of reasons to say that; First computational part of biology make our life&rsquo;s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!<br /> <br /> <strong>2. Avoid the sentence </strong><strong>"I did not know what to do!"</strong><br /> In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.<strong><br /><br /> <strong>3. To make oneself useful</strong></strong><br /> Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)</p><p><strong>4. Care for all</strong><br /> During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask &hellip; what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn&rsquo;t matter to us, then I believe the probability is higher that we fail in research and analysis. <br /> <br /> <strong>5. Be good with people</strong><br /> Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.</p><p>At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don&rsquo;t just blame, suggest a solution.<br /> <br /> That's it. I am looking forward to your thoughts and comments!</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>