<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28922?offset=420</link>
	<atom:link href="https://bioinformaticsonline.com/related/28922?offset=420" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</guid>
	<pubDate>Thu, 14 Nov 2013 13:36:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</link>
	<title><![CDATA[Hidden Markov Models, Viterbi Algorithm, Markov Chain Exploration with script]]></title>
	<description><![CDATA[<p><strong>Hidden Markov Models, the Viterbi Algorithm, and CpG Islands (in VB6)</strong></p><p><strong>Problem :</strong></p><p>The CG island is a stretch of DNA (usually longer than 200 bases) in which the frequency of the CG sequence is higher than other regions. It is also called the CpG island, where "p" simply indicates that "C" and "G" are connected by a phosphodiester bond.<br /><br />CpG islands are often located around the promoters of housekeeping genes (which are essential for general cell functions) or other genes frequently expressed in a cell. At these locations, the CG sequence is not methylated. By contrast, the CG sequences in inactive genes are usually methylated to suppress their expression. The methylated cytosine may be converted to thymine by accidental deamination. Unlike the cytosine to uracil mutation which is efficiently repaired, the cytosine to thymine mutation can be corrected only by the mismatch repair which is very inefficient. Hence, over evolutionary time scales, the methylated CG sequence will be converted to the TG sequence.</p><p>Find step wise explanationand implementation steps at <a href="http://dna.cs.byu.edu/bio465/Labs/hmm.shtml">http://dna.cs.byu.edu/bio465/Labs/hmm.shtml</a></p><p>Source code with explanation <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/</a></p><p>Fore detail understanding of HMM read this excellent tutorial <a href="http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf">http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf</a></p><p>Viterbi Algo at <a href="http://en.wikipedia.org/wiki/Viterbi_path">http://en.wikipedia.org/wiki/Viterbi_path</a></p><p>For firther reading Wiki page <a href="http://en.wikipedia.org/wiki/Hidden_Markov_model">http://en.wikipedia.org/wiki/Hidden_Markov_model</a></p><p>On CpG island paper and for indepth understanding <a href="http://www.biomedcentral.com/1471-2164/12/S2/S10">http://www.biomedcentral.com/1471-2164/12/S2/S10</a></p><p>&nbsp;</p><p>If you are more interested in exploring&nbsp;Markov Chain Exploration and understand it with graphical version please visit <a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1</a></p><p>Reference:</p><p>1.<a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com</a></p><p>2. <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6562/molecular-bioinformatics-lab-mbl</guid>
  <pubDate>Tue, 19 Nov 2013 18:23:27 -0600</pubDate>
  <link></link>
  <title><![CDATA[Molecular Bioinformatics Lab (MBL)]]></title>
  <description><![CDATA[
<p>The main subject of interest in our laboratory is the study of the relationship among sequence, structure, and function in proteins and nucleic acids. Our research can be divided in two major topics:</p>

<p>the study of the sequence-structure relationship<br />(application -&gt; structure prediction)<br />the study of the structure-function relationship<br />(application -&gt; function prediction)</p>

<p>Therefore, anything related to the configuration (sequence) and conformation (structure) in atomic systems of proteins and nucleic acids, and the interaction of these with other elements (function) is of our major interest.</p>

<p>Lab page @ http://melolab.org/mbl/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6818/scientist-positions-gujarat-state-biotechnology-mission</guid>
  <pubDate>Mon, 25 Nov 2013 10:26:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Positions @ Gujarat State Biotechnology Mission]]></title>
  <description><![CDATA[
<p>Gujarat State Biotechnology Mission invite applications [Online Only] under various projects* namely Gujarat Biodiversity Gene Bank (BioGene), Gujarat Institute of Genomics (GIG), Gujarat Institute of Bioinformatics [GIBS] and Gujarat Institute of Marine Biotechnology. Eligible candidates can Apply through online application portal.</p>

<p>1 Scientist E 3</p>

<p>50,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject.</p>

<p>Minimum 8 Yrs. of experience after M.Sc. or 5 Yrs. of experience after Ph.D. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/bioinformatics/Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 40yrs.</p>

<p>2 Scientist B 6</p>

<p>30,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject shall be preferred.</p>

<p>Minimum 3 Yrs. of experience after M.Sc. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/ bioinformatics /Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 35yrs.</p>

<p>The positions are purely on contractual basis for 11 months. Interested candidates can apply online in specified format available at "http://leogen.in/recruit/" The last date of applying is 24th December, 2013. Applications must be submitted online only. Applications submitted in any other format except online prescribed performa will be rejected. Candidates in service must apply through proper channel. Candidates will be required to provide original documents along with duly filled and signed application Performa, as and when called for interview.</p>

<p>For more details please visit the website URL : http://leogen.in/recruit</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7214/lapti-lab</guid>
  <pubDate>Thu, 12 Dec 2013 18:19:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[LAPTI Lab]]></title>
  <description><![CDATA[
<p>The main theme of our research is the understanding of how genetic information is decoded from DNA into RNA and proteins. Someone may find this topic a little strange and argue that we already know how this is happening.</p>

<p>Translational recoding. </p>

<p>RNA editing. </p>

<p>Evolution of the genetic code and translation.</p>

<p>More at http://lapti.ucc.ie/research.html</p>

<p>Lab page http://lapti.ucc.ie/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7362/junior-research-fellow-jrf-project-fellow-kalasalingam-university</guid>
  <pubDate>Thu, 19 Dec 2013 13:23:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow (JRF) / Project Fellow @ Kalasalingam University]]></title>
  <description><![CDATA[
<p>Applications are invited from interested candidates for the post of one Junior Research Fellow / Project Fellow on a purely temporary basis in a time bound research project (3 years) sponsored by Science and Engineering Research Board, Government of India, New Delhi.</p>

<p>Name of the fellowship: Junior Research Fellow (JRF) / Project Fellow</p>

<p>Title of the project: Genome-wide Mapping of Murine Specific Dengue T-cell Epitopes: Computational Prediction, Identification and use as Candidate Vaccines</p>

<p>Duration: 3 years</p>

<p>Fellowship: Rs. 18,000 for first 2 years and Rs. 20,000 for 3rdyear (for M.Tech. candidates)</p>

<p>Rs. 16,000 for first 2 years and Rs. 18,000 for 3rdyear (for M.Sc. candidates with NET qualification)</p>

<p>Rs. 8,000 for first 2 years and Rs. 10,000 for 3rdyear (for M.Sc. candidates without NET qualification)</p>

<p>Qualifications: M.Tech. in Biotechnology / M.Sc. in any branch of Life Sciences</p>

<p>Desirable Experience: Minimum of two years research experience in any of the following areas: Immunology / Microbiology / Gene Manipulation / Bioinformatics</p>

<p>Interested and eligible candidates may apply with their resume along with relevant documents and a passport size photograph to the Principal Investigator by post (or e-mail) on or before December 31, 2013. Only short listed candidates will be called for written test and/or interview. Selected candidate may register for PhD in Kalasalingam University. No TA/DA will be paid for attending interview.</p>

<p>Dr. K. Sundar<br />Principal Investigator (SERB Project)<br />Department of Biotechnology<br />Kalasalingam University<br />Krishnankoil – 626126, Tamil Nadu<br />sundarkr@klu.ac.in</p>
]]></description>
</item>

</channel>
</rss>