(INDIAN COUNCIL OF MEDICAL RESEARCH)

P.O BOX 101,
Dr. M. Miyazaki Marg,
Tajganj, Agra - 282001

Applications are invited for a walk-in interview to be held in the Seminar Hall of the on 15th November, 2013, 9:30 am for temporary positions of JRF, Lab Technician and Field attendant in a ICMR funded project entitled "Elucidating the strain differentiation and transmission dynamics of M. leprae through simple sequence repeats ISSR-PCR marker"

1. JRF (one Post)

Essential qualification: Candidates with M.Sc/IVI.Tech or equivalent degree in any life science related subjects with UGC-CSIR/ICMR/DBT-Net qualified

Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.

Age. Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rs. 6,000 + 20% HRA per Month

2. Lab Technician (One Post)

Essential Qualification: 12th with DMLT/B.SCA4.SC in Life sciences

Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.

Age: Maximum 30 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rs13,760/ Per Month

3. Field Attendant (One Post)

Essential Qualification: 10th Pass

Desirable Qualification: Experience in field work

Age: Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.

Emoluments: Rsl2,040l Per Month

Terms: posts are purely temporary. Appointment will be initially made for a period of one (01) year and may be extended further based on the performance of the candidate up to completion of the project.

Application & Selection procedure: candidates have to appear in the walk-in-interview in person along with an application/CV on plain paper giving details of at educational qualificationq experience and submit photocopies of relevant documents at the time of interview. Selection will be based on the performance of the candidate in the interview' Candidates will not be sent any interview call letter separately. No TA/DA will be paid to the candidate for appearing in the interview. selection is not possible without appearing in the interview. All candidates must report by 9:00am on the date of interview. Advance copy of CV may be sent to m.sarathipartha@gmail.com

Advertisement: http://www.jalma-icmr.org.in/P_S_M_advertisment.pdf

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

Deadline for applications : January 15, 2014.

Description :

We seek a talented and motivated post-doc to develop computational methods for inferring the molecular basis of genetic diseases by integration of personal omics data. Research topics include: identifying causal mutations of rare disease patients by meta-analysis; inferring disease-causing molecular pathways from genotype, human phenotypes, and omics profile of patient-derived cell lines; and causal inference from longitudinal omics studies of patients. The developed methods will be applied to analyze data from our medical collaborators.

Candidates must either hold a PhD in computational biology or bioinformatics, or hold a PhD in physics, statistics, or applied mathematics with practical experience with high-dimensional data analysis. Experience in quantitative genetics is a plus. Applicants must have a proven publication record and an interest for translational research.

The Gagneur lab is a young, lively and multidisciplinary group with a research focus on systems genetics and gene regulation. It is located at the Gene Center of the LMU (University of Munich), an interdisciplinary institution whose 16 independent research groups investigate the regulation of gene expression at all levels - from the underlying molecular mechanisms to the biological system. The institute is located on the biomedical research campus Munich-Grosshadern, offering a dynamic, interactive and internationally oriented research environment. The dynamism of Munich and the proximity of the Alps provide an excellent quality of life.

The salary is according to the TV-L (German academic salary scale).
Applications including a cover letter, CV, and references must be sent by January 15th 2014 to Julien Gagneur (gagneur@genzentrum.lmu.de)

About the lab: http://www.gagneur.genzentrum.lmu.de

Disclaimer: This cartoon is solely designed to create humour and fun, not to offend any computer experts.

Problem :

The CG island is a stretch of DNA (usually longer than 200 bases) in which the frequency of the CG sequence is higher than other regions. It is also called the CpG island, where "p" simply indicates that "C" and "G" are connected by a phosphodiester bond.

CpG islands are often located around the promoters of housekeeping genes (which are essential for general cell functions) or other genes frequently expressed in a cell. At these locations, the CG sequence is not methylated. By contrast, the CG sequences in inactive genes are usually methylated to suppress their expression. The methylated cytosine may be converted to thymine by accidental deamination. Unlike the cytosine to uracil mutation which is efficiently repaired, the cytosine to thymine mutation can be corrected only by the mismatch repair which is very inefficient. Hence, over evolutionary time scales, the methylated CG sequence will be converted to the TG sequence.

Find step wise explanationand implementation steps at http://dna.cs.byu.edu/bio465/Labs/hmm.shtml

Source code with explanation http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/

Fore detail understanding of HMM read this excellent tutorial http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf

Viterbi Algo at http://en.wikipedia.org/wiki/Viterbi_path

For firther reading Wiki page http://en.wikipedia.org/wiki/Hidden_Markov_model

On CpG island paper and for indepth understanding http://www.biomedcentral.com/1471-2164/12/S2/S10

If you are more interested in exploring Markov Chain Exploration and understand it with graphical version please visit http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&lngWId=1

Reference:

1.http://www.planet-source-code.com

2. http://www.tannerhelland.com

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

the study of the sequence-structure relationship
(application -> structure prediction)
the study of the structure-function relationship
(application -> function prediction)

Therefore, anything related to the configuration (sequence) and conformation (structure) in atomic systems of proteins and nucleic acids, and the interaction of these with other elements (function) is of our major interest.

Lab page @ http://melolab.org/mbl/

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl