<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28997?offset=870</link>
	<atom:link href="https://bioinformaticsonline.com/related/28997?offset=870" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6818/scientist-positions-gujarat-state-biotechnology-mission</guid>
  <pubDate>Mon, 25 Nov 2013 10:26:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Positions @ Gujarat State Biotechnology Mission]]></title>
  <description><![CDATA[
<p>Gujarat State Biotechnology Mission invite applications [Online Only] under various projects* namely Gujarat Biodiversity Gene Bank (BioGene), Gujarat Institute of Genomics (GIG), Gujarat Institute of Bioinformatics [GIBS] and Gujarat Institute of Marine Biotechnology. Eligible candidates can Apply through online application portal.</p>

<p>1 Scientist E 3</p>

<p>50,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject.</p>

<p>Minimum 8 Yrs. of experience after M.Sc. or 5 Yrs. of experience after Ph.D. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/bioinformatics/Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 40yrs.</p>

<p>2 Scientist B 6</p>

<p>30,000/-</p>

<p>M.Sc. in Life sciences or Plant Sciences or Biotechnology or Microbiology or Bioinformatics or Ph.D. from a recognized university in any of above subject shall be preferred.</p>

<p>Minimum 3 Yrs. of experience after M.Sc. in responsible position of work in R &amp; D in the area of genomics/ conservation biotechnology/ bioinformatics /Planning/Scientific Administration in Science and technology organization. Highly qualified in the area of modern biology, as evidenced through research experience and proven ability to carry out work in the area of conservation biotechnology. Age limit not exceeding 35yrs.</p>

<p>The positions are purely on contractual basis for 11 months. Interested candidates can apply online in specified format available at "http://leogen.in/recruit/" The last date of applying is 24th December, 2013. Applications must be submitted online only. Applications submitted in any other format except online prescribed performa will be rejected. Candidates in service must apply through proper channel. Candidates will be required to provide original documents along with duly filled and signed application Performa, as and when called for interview.</p>

<p>For more details please visit the website URL : http://leogen.in/recruit</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7214/lapti-lab</guid>
  <pubDate>Thu, 12 Dec 2013 18:19:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[LAPTI Lab]]></title>
  <description><![CDATA[
<p>The main theme of our research is the understanding of how genetic information is decoded from DNA into RNA and proteins. Someone may find this topic a little strange and argue that we already know how this is happening.</p>

<p>Translational recoding. </p>

<p>RNA editing. </p>

<p>Evolution of the genetic code and translation.</p>

<p>More at http://lapti.ucc.ie/research.html</p>

<p>Lab page http://lapti.ucc.ie/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7362/junior-research-fellow-jrf-project-fellow-kalasalingam-university</guid>
  <pubDate>Thu, 19 Dec 2013 13:23:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow (JRF) / Project Fellow @ Kalasalingam University]]></title>
  <description><![CDATA[
<p>Applications are invited from interested candidates for the post of one Junior Research Fellow / Project Fellow on a purely temporary basis in a time bound research project (3 years) sponsored by Science and Engineering Research Board, Government of India, New Delhi.</p>

<p>Name of the fellowship: Junior Research Fellow (JRF) / Project Fellow</p>

<p>Title of the project: Genome-wide Mapping of Murine Specific Dengue T-cell Epitopes: Computational Prediction, Identification and use as Candidate Vaccines</p>

<p>Duration: 3 years</p>

<p>Fellowship: Rs. 18,000 for first 2 years and Rs. 20,000 for 3rdyear (for M.Tech. candidates)</p>

<p>Rs. 16,000 for first 2 years and Rs. 18,000 for 3rdyear (for M.Sc. candidates with NET qualification)</p>

<p>Rs. 8,000 for first 2 years and Rs. 10,000 for 3rdyear (for M.Sc. candidates without NET qualification)</p>

<p>Qualifications: M.Tech. in Biotechnology / M.Sc. in any branch of Life Sciences</p>

<p>Desirable Experience: Minimum of two years research experience in any of the following areas: Immunology / Microbiology / Gene Manipulation / Bioinformatics</p>

<p>Interested and eligible candidates may apply with their resume along with relevant documents and a passport size photograph to the Principal Investigator by post (or e-mail) on or before December 31, 2013. Only short listed candidates will be called for written test and/or interview. Selected candidate may register for PhD in Kalasalingam University. No TA/DA will be paid for attending interview.</p>

<p>Dr. K. Sundar<br />Principal Investigator (SERB Project)<br />Department of Biotechnology<br />Kalasalingam University<br />Krishnankoil – 626126, Tamil Nadu<br />sundarkr@klu.ac.in</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7567/asst-professor-jaipur-national-university</guid>
  <pubDate>Fri, 27 Dec 2013 19:54:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Asst. Professor @ JAIPUR NATIONAL UNIVERSITY]]></title>
  <description><![CDATA[
<p>JAIPUR NATIONAL UNIVERSITY</p>

<p>Established by Government of Rajasthan</p>

<p>Approved by UGC under Sec 2(f) of UGC Act 1956</p>

<p>ADVERTISEMENT FOR FACULTY POSITION AT JAIPUR NATIONAL UNIVERSITY,JAIPUR</p>

<p>Jaipur National University, Jaipur is a premier centre of learning, providing various integrated and interdisciplinary programmes of study and research in the country. With the opening of the School of Distance Education &amp; Learning, JNU has taken education to the doorsteps of those aspirants who, for some reason, could not be a part of regular stream of education. In this era of competition &amp; ambition for excellence, it has become imperative to have quality education &amp; an alert mind coupled with the right attitude to carry onself, and for this, JNU happens to be the most sought after destination.</p>

<p>School Of Life Sciences: Bioinformatics, Chemistry</p>

<p>Total no of Post: 04</p>

<p>Education:</p>

<p>PG – M.Sc /M.Tech Bioinformatics</p>

<p>PG – M.Sc /M.Tech Chemistry</p>

<p>Experience:</p>

<p>Candidate with 1-2 years of teaching experience in college/ University will be preffered. Freshers may also apply.</p>

<p>Compensation: Compensation will not be a problem for the right candidate</p>

<p>HOW TO APPLY:</p>

<p>SEND THE UPDATED RESUME THROUGH MAIL OR POST AT</p>

<p>dsbhatia5@yahoo.com</p>

<p>contact no: 7568246839</p>

<p>Website: http://www.jnujaipur.ac.in</p>

<p>Please mail your resume to Prof.D.S.Bhatia</p>

<p>Email Address: dsbhatia5@yahoo.com</p>

<p>Ph:, +917568246839</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38224/novograph-building-whole-genome-graphs-from-long-read-based-de-novo-assemblies</guid>
	<pubDate>Thu, 15 Nov 2018 12:48:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38224/novograph-building-whole-genome-graphs-from-long-read-based-de-novo-assemblies</link>
	<title><![CDATA[NovoGraph: building whole genome graphs from long-read-based de novo assemblies]]></title>
	<description><![CDATA[<p><span>NovoGraph: building whole genome graphs from long-read-based de novo assemblies</span></p>
<p><span><span>An algorithmically novel approach to construct a genome graph representation of long-read-based&nbsp;</span><em>de novo</em><span>&nbsp;sequence assemblies. We then provide a proof of principle by creating a genome graph of seven ethnically-diverse human genomes.</span></span></p>
<p>&nbsp;</p>
<p>https://f1000research.com/articles/7-1391/v1</p><p>Address of the bookmark: <a href="https://github.com/NCBI-Hackathons/NovoGraph" rel="nofollow">https://github.com/NCBI-Hackathons/NovoGraph</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7933/senior-programmer-biotech-park</guid>
  <pubDate>Mon, 20 Jan 2014 04:50:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[SENIOR PROGRAMMER @ Biotech Park]]></title>
  <description><![CDATA[
<p>Advt. No. (1)/BP/2014<br />A walk-in-interview will be held in the Biotech Park Office at Sector G, Jankipuram, Kursi Road, Lucknow (U.P.) January 31, 2014 at 11.00 A.M. for the following posts of DBT sponsored project tenable at Biotech Park. Interested candidates fulfilling the requisite qualifications, experience and age as given below, on the date of interview, may appear before the Selection Committee. The candidate will have to join immediately. Appointment will be made initially for six months extendable on satisfactory performance till the duration of the project.<br />INTERVIEW ON January 31, 2014 at 11.00 A.M.<br /> <br />SENIOR PROGRAMMER (ONE POST)<br />Educational Qualification<br />M.Sc./B. Tech Bioinformatics with minimum 60% marks with two years of relevant experience	<br />Job Requirement	<br />Development of databases in multi user environment and application softwares, updating and maintenance of website, Drug designing and QSAR study etc.<br />Desirable<br />Knowledge of Bioinformatics tools, Windows, Linux, C++, JAVA / JAVA Script, Visual Basic, CGI, DBMS/RDBMS and HTML. Experience in various domains of bioinformatics such as structure based drug designing, Newtonian dynamics and QSAR studies.<br />Age<br />Below 35 years (as on the date of interview)<br />Emoluments<br />Rs. 12,000/- per month fixed.<br />Note: All the candidates should report for interview on or before 10.30 A.M<br />General Conditions<br />The aforesaid positions are purely temporary and do not give the incumbent any right whatsoever for appointment on regular basis.<br />The applicant will have to submit typed and duly signed application on plain paper on the day of interview stating:<br />    (a) Advertisement No.<br />    (b) Position applied for<br />    (c) Name of Applicant (in Block letters)<br />    (d) Father’s Name<br />    (e) Date of Birth<br />    (f) Sex<br />    (g) Age as on the date of interview (dd / mm / yy )<br />    (h) Address (Permanent &amp; correspondence)<br />    (i) Educational Qualifications (High School onwards) with examination passed, year, % marks, subjects<br />    (j) Employment experience, if any i.e. Name of employer, nature of employment, date of joining and leaving.<br />Applications must be accompanied by a latest passport size photograph and attested copies of certificates<br />Original certificates/degree and testimonials should be produced by the candidate for verification at the time of interview.</p>

<p>Tenure: Initially upto six months and extendable based on performance.<br />The upper age limit can be relaxed up to 5 years in the case of applicant belonging to SC/ST/Woman/Physically handicapped and 3 years for OBCs.<br />No TA/DA will be paid for attending the interview.<br />More at http://www.biotechpark.org.in/index1.htm</p>
]]></description>
</item>

</channel>
</rss>