We are seeking a highly motivated young PhD student with strong interest in high throughput data analysis.
Detailed descriptions of our recent research activities may be found here:
http://www.humanitas-research.org/condorelli-gianluigi-md-phd/

Position is available starting from October/November. A probationary period of one month will be required.

Please send a CV along with a cover letter stating the reasons for applying and contact details of one or more referees to Dr. Paolo Kunderfranco (paolo.kunderfranco@humanitasresearch.it).

Sector 8, Dwarka, Delhi -110077

WALK IN INTERVIEW

One position of project fellow is to be filled up in a DRL- funded research project on Molecular and morphological characterization of An. fluviatilis in North-eastern states and bordering areas. The position is purely temporary for one year and can be extended

Essential qualifications

Master’s degree in any branch of Life Sciences with hands on experience in molecular biology and/or bioinformatics.

Age limit: 28 years, (relaxation for SC/ST/OBC candidates as per government of India rules)

Stipend: Rs.12, 000.00 per month (fixed)

Eligible candidates may walk in for an interview on 15 November 2013 at 11 AM at the above mentioned address along with a copy of CV (with a passport size photograph affixed), photocopies of all mark sheets/certificates and originals (for verifications). No TA/DA will be paid for attending the interview .Registration of candidates will start at 10:00AM and end at 10:45 AM.

Advertisement: http://www.mrcindia.org/vacancy/add-4.doc

Lab page @ http://graveleylab.cam.uchc.edu/Graveley/index.html

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Location : The Luxembourg Centre for Systems Biomedicine (LCSB) at the University of Luxembourg, Luxembourg, Luxembourg
Deadline for applications : unknown.
Description :

The Luxembourg Centre for Systems Biomedicine (LCSB) was created within the Health Technologies Initiative from the Government of Luxembourg as one of the research priorities of the University of Luxembourg. The LCSB is an Interdisciplinary Centre of the University that combines experimental and computational approaches to analyse complex biological systems and disease processes. The Computational Biology Group (CBG) provides the LCSB with a solid infrastructure in developing theoretical framework for computational modeling on biomedical problems, especially in the area of network biology in the context of cellular programming/reprogramming. The CBG group includes researchers with theoretical, computational and wet lab backgrounds, thereby providing an unusually interdisciplinary environment.
The Computational Biology Group seeks a highly-skilled Ph.D. student to work on an exciting project on reconstruction and analysis of an integrated gene regulatory network model to elucidate key mechanisms of cellular reprogramming. The model will rely on the integration and mining of diverse transcriptomics and epigenomics data of different cell types from the Central Nervous System. The Ph.D. student is expected to collaborate with other members of the CBG to develop a computational methodology aiming at designing, in-silico, cellular reprogramming events, with a focus on the nervous system. This project will be carried out in collaboration with Prof. Noel Buckleys lab at Kings College London.
Requirements of the ideal candidate:
Master degree in Bioinformatics, Computer Science, Biology or a related discipline
Prior experience in mathematical modelling of biological networks, especially in network inference and analysis
Excellent working knowledge in English.
.
We offer:
Full contract for Ph.D. student for three years with possibility of renewal
Opportunity to do applied research to medical problems within a highly dynamic research institution (LCSB) and in collaboration with internationally recognized partners
An exciting international environment
A very competitive salary

For further information, please contact:

Prof. Dr. Antonio del Sol
E-mail: antonio.delsol@uni.lu

Applications should contain the following documents:
A detailed curriculum vitae
cover letter mentioning the reference number
description of past research experience and future interests
name and addresses of three referees

All applications should be sent preferably in electronic version until December 31st, 2013 to the following address:

Luxembourg Centre for Systems Biomedicine (LCSB)
University of Luxembourg
7, avenue des Hauts-Fourneaux
L-4362 Esch-sur-Alzette
Tel: +352-466644-6982 (Office)
Email: antonio.delsol@uni.lu
http://www.lcsb.lu

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

Duration: 1 year

Funding Source: Institutional
Salary on grant: B2 (€ 22.000/year gross)
Contact Person (Referent): Tommaso Mazza
Ref. E-Mail: t.mazza@css-mendel.it
Tel: +39 06 44160526
Fax: +39 06 44160548

Job Description: The bioinformatics unit at IRCCS Casa Sollievo della Sofferenza - Mendel laboratory in Rome is looking for one young PhD bioinformatician with specific experience and/or interest in the analysis of transcriptomic data.

The candidate will be mainly in charge of developing research on a range of hot applications and projects, dealing with microarrays, RNA-Seq and miRNA-Seq data. Main activities will be: (i) data analysis (short-reads mapping, variants call and annotation, functional enrichment analysis of gene expression data); (ii) networks analysis and simulation (artificial knockout, redundancy and lethality analysis, gene set essentiality); (iii) developing of ad-hoc software solutions/routines on clusters of CPUs and GPUs.

The correct cultural background (training in Biology / Computer Science / Statistics or a mix of the three) and a strong interest in working with high throughput data analysis will be considered at the same level of specific experience in the above-mentioned fields.
Knowledge of molecular modeling and simulation and one of these languages: python, perl, R, Java, C++, C# is a golden plus. Good knowledge of Scientific English will be positively evaluated for this position, together with good presentation and teamwork skills.

A CV with one professional reference, details on educational background and of the biological and/or bioinformatic and/or data analysis skills and experience should be sent by email for a preliminary selection to: Tommaso Mazza, CSS-Mendel: t.mazza@css-mendel.it

Context
Casa Sollievo della Sofferenza is an Institute for hospitalization, care, and scientific research located in San Giovanni Rotondo, Italy. It integrates clinical assistance (with inpatient and outpatient facilities) and research. It has an affiliate institute, CSS-Mendel, located in Rome. Between the two sites, it employs over 100 researchers who focus on genetics. The Center is equipped with state of the art genomics technology (SOLiD 5500XL next generation sequencer, Illumina MiSeq, Affymetrix/Agilent microarray platforms, etc) as well as a dedicated high performance computing facility, a non-conventional workstation of GPUs and a short- and long-term storage disk.

Applications
Candidates should send:
• a cover letter explaining the role they would like to undertake within the Center, even if it is not listed in this job adv, stating clearly why they would be a good fit to the proposed role, and what they would bring to the Center in terms of expertise, ideas, talent;
• a CV including a list of publications;
• List of referees;

More at http://www.css-mendel.it/

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser