<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29029?offset=740</link>
	<atom:link href="https://bioinformaticsonline.com/related/29029?offset=740" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/2423/cancers-origins-revealed</guid>
	<pubDate>Thu, 15 Aug 2013 13:06:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/2423/cancers-origins-revealed</link>
	<title><![CDATA[Cancer's origins revealed]]></title>
	<description><![CDATA[<p>Researchers have provided the first comprehensive compendium of mutational processes that drive tumour development. Together, these mutational processes explain most mutations found in 30 of the most common cancer types. This new understanding of cancer development could help to treat and prevent a wide-range of cancers.<br /><br />More at &gt;&gt; http://www.sanger.ac.uk/about/press/2013/130814.html</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2464/computer-theory-genetics-george-chao-at-tedxumnsalon</guid>
	<pubDate>Thu, 15 Aug 2013 22:08:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2464/computer-theory-genetics-george-chao-at-tedxumnsalon</link>
	<title><![CDATA[Computer Theory & Genetics: George Chao at TEDxUMNSalon]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/7_GL17oiak8" frameborder="0" allowfullscreen></iframe>George Chao is an undergraduate senior studying Genetics and Computer Science at the University of Minnesota. Having started genetics research as soon as he entered the university, he has worked in labs spanning multiple disciplines as well as in Japan. Some of these researches include developmental genetics in Drosophila, computational techniques for analyzing protein interactions, and helping with the development of algorithms to analyze motion capture data of patients with neck pain. During this time, George steadily developed a fascination with the field of bioinformatics, the study of using computational techniques to learn from genetic data. He would like to go into a career of research into the application of bioinformatics in various fields.

----

The individuals involved with TEDxUMN have a passion for bringing together the great thinkers at the University of Minnesota and giving them the opportunity to share their ideas worth spreading and to discuss our shared future. We provide these great people the opportunity to share these ideas on a global stage and with an incredibly diverse audience. We believe in the power of ideas to change attitudes, lives and ultimately the world.

Check out TEDxUMN at http://www.TEDxUMN.com/

In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/2680/4-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products</guid>
  <pubDate>Tue, 20 Aug 2013 08:42:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[4 positions in high throughput computational metagenomics and systems biology of natural products]]></title>
  <description><![CDATA[
<p>The Research and Innovation Centre at the Fondazione Edmund Mach (CRI-FEM) is a major international research institution with strong and expanding research interests in Fruit Genomics, Quality Health and Nutrition of Agricultural Products, Agro-ecosystems Sustainability, Biodiversity and Molecular Ecology.</p>

<p>CRI-FEM hosts GMPF, an International PhD Program in Genomics and Molecular Physiology of Fruit Crops and Fox-Lab, an international initiative in forest and wood research.<br />4 positions in high throughput computational metagenomics and systems biology of natural products - deadline September 30th, 2013</p>

<p>To support interdisciplinary research, CRI-FEM has established the Computational Biology Centre (CBC).</p>

<p>The mission of CBC is to develop systems-level integrative approaches connecting genotype to phenotype with a special focus on genome-wide analyses and next generation sequencing technologies. </p>

<p>CRI-FEM is seeking to attract 4 high calibre scientists in the areas of high throughput computational metagenomics and systems biology of natural products.</p>

<p>Here below the list of the 4 positions:</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Post-doc-in-Metagenomics-screening-and-characterization-of-bioactive-microbial-compounds-130_CRI_MSC</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Post-doc-in-Modeling-transcriptional-control-programs-at-a-genome-wide-scale-131_CRI_TCP</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Technologist-in-Purification-of-plant-bioactive-molecules-from-complex-matrixes-132_CRI_PBM</p>

<p>http://www.fmach.it/eng/Servizi-Generali/Lavora-con-noi/Annunci-lavoro-e-borse-di-studio/Details-of-the-5-positions-in-high-throughput-computational-metagenomics-and-systems-biology-of-natural-products-deadline-September-30th-2013/Researcher-in-Methods-for-algorithmic-and-integrative-genomics-for-metagenomics-134_CRI_AIG</p>

<p>For more information on the CBC or informal inquiries on the advertised positions please contact Dr Duccio Cavalieri (e-mail duccio.cavalieri@fmach.it).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2759/dynamic-programming-alignment</guid>
	<pubDate>Thu, 22 Aug 2013 09:38:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2759/dynamic-programming-alignment</link>
	<title><![CDATA[Dynamic Programming Alignment]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/EWJnDMKBEv0" frameborder="0" allowfullscreen></iframe>lecture 9, Chem. C100, Spring 2013, UCLA]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4178/phd-position-in-biochemistry-towards-bioinformatics-at-the-department-of-biochemistry-and-biophysics</guid>
  <pubDate>Tue, 03 Sep 2013 06:09:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[PhD position in biochemistry towards bioinformatics at the Department of Biochemistry and Biophysics.]]></title>
  <description><![CDATA[
<p>PhD position in biochemistry towards bioinformatics at the Department of Biochemistry and Biophysics. Reference number: SU FV-2293-13. Deadline for application: September 10, 2013.</p>

<p>Project title: Functional Inference from Domain Architecture and Orthology</p>

<p>Requirements</p>

<p>To be accepted as a PhD student, credits corresponding to four years of full-time studies at the undergraduate level are required, including credits corresponding to at least two years of fulltime studies in chemistry, life sciences or physics, depending on the program. The credits should include courses at the advanced level (second cycle) corresponding to one year and of these one semester should be a degree thesis. In order to facilitate the evaluation of merits and suitability for the PhD studies the curriculum vitae (CV) should contain information about the extent and focus of the academic studies. The quantity (as part of an academic year) and the quality mark of courses in chemistry and physics are of particular interest. The title, number of credits and the length in full-time months of undergraduate thesis and project work, should be specified.</p>

<p>Information</p>

<p>More information about the project can be provided by the project leader. General information about the PhD training program may be requested from the director of graduate studies, Stefan Nordlund, stefan@dbb.su.se or from Lena Mäler, Head of Department (prefekt), lenam@dbb.su.se</p>

<p>Further information on the web:</p>

<p>The Department of Biochemistry and Biophysics: www.dbb.su.se</p>

<p>Stockholm University: www.su.se/english</p>

<p>Faculty of Science: www.science.su.se/english</p>

<p>The handbook for postgraduate students: www.doktorandhandboken.nu/english</p>

<p>Application The application should contain a personal letter (a letter of intent explaining why you are interested in the specific project, why you are interested in studying for a PhD, what you hope to accomplish during your PhD studies, and what skills you can bring to this project), a curriculum vitae, a list of two persons who may act as referees (with telephone numbers and e-mail addresses), copies of degree certificates and transcripts of academic records, and a copy of your undergraduate thesis and articles, if any.</p>

<p>In order to apply for this position, please use the Stockholm University web-based application form (where it is possible to select language):</p>

<p>To the application form for this position.</p>

<p>Welcome with your application no later than September 10, 2013.</p>

<p>Project leader: Erik Sonnhammer, Erik.Sonnhammer@sbc.su.se,<br />www.sonnhammer.sbc.su.se</p>

<p>Advertisement: http://www.su.se/english/about/vacancies/phd-studies/phd-position-in-biochemistry-towards-bioinformatics-1.143446</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

</channel>
</rss>