<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29108?offset=490</link>
	<atom:link href="https://bioinformaticsonline.com/related/29108?offset=490" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5702/research-fellow-in-bioinformatics-queens-university-belfast-institute-for-global-food-security-school-of-biological-sciences</guid>
  <pubDate>Thu, 17 Oct 2013 04:33:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellow in Bioinformatics @  Queen's University Belfast -Institute for Global Food Security, School of Biological Sciences]]></title>
  <description><![CDATA[
<p>Ref: 13/102900</p>

<p>Available immediately until 30th November 2015, to work on the development of bioinformatics approaches to aid analysis of data derived from the metabolomic profiling of biological matrices. The successful applicant will lead research activities on an FP7 funded EU-wide collaborative project aimed at establishing biomarker-based strategies for high throughput diagnostic screening. Key tasks will involve multivariate analysis of large datasets, bioinformatic-based selection and validation of identified markers, construction of metabolomic spectral profile databases and development of machine learning/database searching approaches amenable to analytical screening techniques. This position will offer the opportunity to travel and undertake work with project collaborators based in the Republic of Ireland and Europe.</p>

<p>Informal enquiries may be directed to Dr Terry McGrath, email: terry.mcgrath@qub.ac.uk.</p>

<p>Anticipated interview date: Thursday 31st October 2013<br />Salary scale: £30,424 – £39,649 per annum (including contribution points)<br />Closing date: Monday 21st October 2013  </p>

<p>Telephone (028) 90973044 FAX: (028) 90971040 or e-mail on personnel@qub.ac.uk</p>

<p>The University is committed to equality of opportunity and to selection on merit.  It therefore welcomes applications from all sections of society and particularly welcomes applications from people with a disability. </p>

<p>Fixed term contract posts are available for the stated period in the first instance but in particular circumstances may be renewed or made permanent subject to availability of funding.</p>

<p>More @ https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open?VACANCY_ID=5616943npO&amp;WVID=6273090Lgx&amp;LANG=USA</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5947/jrf-national-jalma-institute-of-leprosy-and-other-mycobacterial-diseases</guid>
  <pubDate>Mon, 28 Oct 2013 10:42:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF @ NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES]]></title>
  <description><![CDATA[
<p>NATIONAL JALMA INSTITUTE OF LEPROSY AND OTHER MYCOBACTERIAL DISEASES</p>

<p>(INDIAN COUNCIL OF MEDICAL RESEARCH)</p>

<p>P.O BOX 101,<br />Dr. M. Miyazaki Marg,<br />Tajganj, Agra - 282001</p>

<p>Applications are invited for a walk-in interview to be held in the Seminar Hall of the on 15th November, 2013, 9:30 am for temporary positions of JRF, Lab Technician and Field attendant in a ICMR funded project entitled "Elucidating the strain differentiation and transmission dynamics of M. leprae through simple sequence repeats ISSR-PCR marker"</p>

<p>1. JRF (one Post)</p>

<p>    Essential qualification: Candidates with M.Sc/IVI.Tech or equivalent degree in any life science related subjects with UGC-CSIR/ICMR/DBT-Net qualified</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age. Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs. 6,000 + 20% HRA per Month</p>

<p>2. Lab Technician (One Post)</p>

<p>    Essential Qualification: 12th with DMLT/B.SCA4.SC in Life sciences</p>

<p>    Desirable qualification: Experience in Molecular Biology/Computational Biology will be preferred.</p>

<p>    Age: Maximum 30 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>    Emoluments: Rs13,760/ Per Month</p>

<p>3. Field Attendant (One Post)</p>

<p>Essential Qualification: 10th Pass</p>

<p>Desirable Qualification: Experience in field work</p>

<p>Age: Maximum 28 years as on 11.11.2013. Age relaxation as per GOI rules.</p>

<p>Emoluments: Rsl2,040l Per Month</p>

<p>Terms: posts are purely temporary. Appointment will be initially made for a period of one (01) year and may be extended further based on the performance of the candidate up to completion of the project.</p>

<p>Application &amp; Selection procedure: candidates have to appear in the walk-in-interview in person along with an application/CV on plain paper giving details of at educational qualificationq experience and submit photocopies of relevant documents at the time of interview. Selection will be based on the performance of the candidate in the interview' Candidates will not be sent any interview call letter separately. No TA/DA will be paid to the candidate for appearing in the interview. selection is not possible without appearing in the interview. All candidates must report by 9:00am on the date of interview. Advance copy of CV may be sent to m.sarathipartha@gmail.com</p>

<p>Advertisement: http://www.jalma-icmr.org.in/P_S_M_advertisment.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7815/post-doc-in-systems-genetics</guid>
  <pubDate>Wed, 08 Jan 2014 19:23:37 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Systems Genetics]]></title>
  <description><![CDATA[
<p>Gagneur lab at Gene Center, Ludwig-Maximilians-Universitaet, Munich, Germany</p>

<p>Deadline for applications : January 15, 2014.</p>

<p>Description :</p>

<p>We seek a talented and motivated post-doc to develop computational methods for inferring the molecular basis of genetic diseases by integration of personal omics data. Research topics include: identifying causal mutations of rare disease patients by meta-analysis; inferring disease-causing molecular pathways from genotype, human phenotypes, and omics profile of patient-derived cell lines; and causal inference from longitudinal omics studies of patients. The developed methods will be applied to analyze data from our medical collaborators.</p>

<p>Candidates must either hold a PhD in computational biology or bioinformatics, or hold a PhD in physics, statistics, or applied mathematics with practical experience with high-dimensional data analysis. Experience in quantitative genetics is a plus. Applicants must have a proven publication record and an interest for translational research.</p>

<p>The Gagneur lab is a young, lively and multidisciplinary group with a research focus on systems genetics and gene regulation. It is located at the Gene Center of the LMU (University of Munich), an interdisciplinary institution whose 16 independent research groups investigate the regulation of gene expression at all levels - from the underlying molecular mechanisms to the biological system. The institute is located on the biomedical research campus Munich-Grosshadern, offering a dynamic, interactive and internationally oriented research environment. The dynamism of Munich and the proximity of the Alps provide an excellent quality of life.</p>

<p>The salary is according to the TV-L (German academic salary scale).<br />Applications including a cover letter, CV, and references must be sent by January 15th 2014 to Julien Gagneur (gagneur@genzentrum.lmu.de)</p>

<p>About the lab: http://www.gagneur.genzentrum.lmu.de</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</guid>
	<pubDate>Thu, 14 Nov 2013 13:36:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/6380/hidden-markov-models-viterbi-algorithm-markov-chain-exploration-with-script</link>
	<title><![CDATA[Hidden Markov Models, Viterbi Algorithm, Markov Chain Exploration with script]]></title>
	<description><![CDATA[<p><strong>Hidden Markov Models, the Viterbi Algorithm, and CpG Islands (in VB6)</strong></p><p><strong>Problem :</strong></p><p>The CG island is a stretch of DNA (usually longer than 200 bases) in which the frequency of the CG sequence is higher than other regions. It is also called the CpG island, where "p" simply indicates that "C" and "G" are connected by a phosphodiester bond.<br /><br />CpG islands are often located around the promoters of housekeeping genes (which are essential for general cell functions) or other genes frequently expressed in a cell. At these locations, the CG sequence is not methylated. By contrast, the CG sequences in inactive genes are usually methylated to suppress their expression. The methylated cytosine may be converted to thymine by accidental deamination. Unlike the cytosine to uracil mutation which is efficiently repaired, the cytosine to thymine mutation can be corrected only by the mismatch repair which is very inefficient. Hence, over evolutionary time scales, the methylated CG sequence will be converted to the TG sequence.</p><p>Find step wise explanationand implementation steps at <a href="http://dna.cs.byu.edu/bio465/Labs/hmm.shtml">http://dna.cs.byu.edu/bio465/Labs/hmm.shtml</a></p><p>Source code with explanation <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/</a></p><p>Fore detail understanding of HMM read this excellent tutorial <a href="http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf">http://www.cs.ubc.ca/~murphyk/Software/HMM/labman2.pdf</a></p><p>Viterbi Algo at <a href="http://en.wikipedia.org/wiki/Viterbi_path">http://en.wikipedia.org/wiki/Viterbi_path</a></p><p>For firther reading Wiki page <a href="http://en.wikipedia.org/wiki/Hidden_Markov_model">http://en.wikipedia.org/wiki/Hidden_Markov_model</a></p><p>On CpG island paper and for indepth understanding <a href="http://www.biomedcentral.com/1471-2164/12/S2/S10">http://www.biomedcentral.com/1471-2164/12/S2/S10</a></p><p>&nbsp;</p><p>If you are more interested in exploring&nbsp;Markov Chain Exploration and understand it with graphical version please visit <a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1</a></p><p>Reference:</p><p>1.<a href="http://www.planet-source-code.com/vb/scripts/ShowCode.asp?txtCodeId=75049&amp;lngWId=1">http://www.planet-source-code.com</a></p><p>2. <a href="http://www.tannerhelland.com/1187/hidden-markov-models-viterbi-algorithm-cpg-islands-in-vb6/">http://www.tannerhelland.com</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>