Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Starting 15th July 2015, the position relates to a project specifically for in silico drug docking, screening, design, optimisation and linkage with active chemists.

Experience in many docking softwares and operating systems is essential.

Additional experience in bioinformatics and computational biology tools will be useful.

Submit curriculum vitae to: sb.icgeb@gmail.com

Closing date: 5 July 2015

The OpenCPU JavaScript client library provides the most seamless integration of R and JavaScript available today.

OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source example apps are available from Github.

Installing your own OpenCPU server is super easy and only takes a few minutes.

More at https://www.opencpu.org/

For informal enquiries please contact Anne Walsh via email: anne.walsh@bristol.ac.uk.

Apply at http://www.bris.ac.uk/jobs/find/details.html?nPostingID=3639&nPostingTargetID=13346&option=28&sort=DESC&respnr=1&ID=Q50FK026203F3VBQBV7V77V83&JobNum=ACAD101624&Resultsperpage=10&lg=UK&mask=uobext

Pay Scale: Rs. 40,000/-per month +HRA (as admissible) for Ph.D. holders and Rs. 38,000/-p.m. + HRA (as admissible) for Master degree holder

Qualifications: a)Essential :

Ph.D.in Biotechnology/ Molecular B iology/ Genetics & Plant Breeding/ Bioinformatics ( Should have the degree in life sciences at gra duate level) OR Post - Graduation in Biotechnology/ Molecular Biology/ Bioinformati cs/Genetics & Plant Breeding

or equivalent with at least two years of research experience and 60% marks. ( should have a degree in life sciences at graduate level)

b) Desirable :

1. Working experience in plant molecular biology

2. Knowledge of Computational Genomics/Proteomics/ Bioinformatics

3. Working knowledge on Computer programming

Walk-in Interview will be held at The Indian Institute of Spices Research, Marikunnu P.O., Kozikode-673012, Kerala on 28/7/2015 at 10.00 AM.

For more details: http://www.spices.res.in/pdf/Mining%20and%20Validation%20Website.pdf

Desirable qualification: M.Sc (Life Sciences) with Bioinformatics knowledge and hands on molecular biology tools.

Age: Not exceeding 30 years on the last date of receipt of application

Job work: Molecular modelling studies, Database curation, Metagenomic studies on Dengue virus

Advertisement: http://vcrc.res.in/writereaddata/BIPrj15.pdf

WALK-IN-INTERVIEW (EMPLOYMENT NOTIFICATION)

Eligible candidates are invited to apply for the following post on the ad hoc research project entitled “Biomedical Informatics Centre’s of ICMR” - funded by ICMR at this Institute. The Applications will be received from the individuals on 31st July, 2015 between 9:30 A.M. and 10:30 A.M. at Conference Hall, NIN, Tarnaka, Hyderabad.

Late applications will not be entertained after 10:30 A.M. at any circumstances.

The Candidates may download the Application Form from NIN website: www.ninindia.org

Selection Procedure: Written test and Interview will be conducted to the eligible candidates, if the large numbers of candidates are found to be eligible in the screening. If the lesser number of candidates are found to be eligible in the screening, interview will be conducted only to the short listed candidates for final selection. The names of the shortlisted candidates will be displayed on the Notice Board, which is kept in front of the Conference Hall by 11:30 A.M.

Date of Written Test / Interview: 31st July, 2015. The essential qualification, experience, consolidated Pay and service tenure are as under:

1. Scientist-II (no. of vacancies -1 No.) (UR)

Essential Qualifications :

(i) First Class Master’s Degree in Bio-informatics/ Life Sciences form a recognized University with 4 years R&D experience in the biomedical informatics subject. (or)

(ii) 2nd Class M.Sc./ M.Tech. in Bio-informatics + Ph.D. in the relevant subject from recognized University with 4 years research experience in the biomedical informatics subject.

Age limit : Not exceeding 40 years. Cons.

Pay : Rs.45,954/- p.m. plus 30% HRA p.m. (fixed) without any other allowances.

Tenure : Initially upto 29th February, 2016 and extendable for three more years based on the performance of the candidate and funds position.

Note: Age relaxation will be given to the deserving Candidates. The short listed candidates should bring all original certificates of educational qualification (from SSC onwards), experience, SC/ST/OBC Community Certificate / PH Certificates along with a pass port size photograph and set of Photo copies duly attested for attending the Written Test/Interview. The persons belonging to Other Backward Category should bring the latest O.B.C. (Non-creamy layer) Certificate issued by the respective Tahsildar/ MRO specifically issued for the purpose of applying for Central Government Post. No TA/DA will be paid for attending the Written Test /Interview.

GENERAL CONDITIONS: The conditions of employment will be the same as are for the project staff on contract basis. The candidates have no right to claim for any regular employment at this Institute. The Director In-charge & Appointing Authority has the right to accept / reject any application without assigning any reason/s and no correspondence in this matter will be entertained.

More at http://ninindia.org/31July2015.pdf