<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29142?offset=1350</link>
	<atom:link href="https://bioinformaticsonline.com/related/29142?offset=1350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</guid>
	<pubDate>Mon, 19 Aug 2013 01:12:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/2573/most-commonly-used-awk-by-bioinformatician</link>
	<title><![CDATA[Most Commonly used Awk by Bioinformatician]]></title>
	<description><![CDATA[<p style="text-align: center;">&nbsp;</p><p>Awk is a programming language that is specifically designed for quickly manipulating space delimited data. Although you can achieve all its functionality with Perl, awk is simpler in many practical cases.</p><p>Why awk? You can replace a pipeline of 'stuff | grep | sed | cut...' with a single call to awk. For a simple script, most of the timelag is in loading these apps into memory, and it's much faster to do it all with one. This is ideal for something like an openbox pipe menu where you want to generate something on the fly. You can use awk to make a neat one-liner for some quick job in the terminal, or build an awk section into a shell script. You can find a lot of online tutorials, but here I will only show a few examples which cover most of bioinformatician daily uses of awk.</p><p>choose rows where column 3 is larger than column 5:</p><p>awk '$3&gt;$5' input.txt &gt; output.txt</p><p>extract column 2,4,5:</p><p>awk '{print $2,$4,$5}' input.txt &gt; output.txt</p><p>awk 'BEGIN{OFS="\t"}{print $2,$4,$5}' input.txt</p><p>show rows between 20th and 80th:</p><p>awk 'NR&gt;=20&amp;&amp;NR&lt;=80' input.txt &gt; output.txt</p><p>calculate the average of column 2:</p><p>awk '{x+=$2}END{print x/NR}' input.txt</p><p>regex (egrep):</p><p>awk '/^test[0-9]+/' input.txt</p><p>calculate the sum of column 2 and 3 and put it at the end of a row or replace the first column:</p><p>awk '{print $0,$2+$3}' input.txt</p><p>awk '{$1=$2+$3;print}' input.txt</p><p>join two files on column 1:</p><p>awk 'BEGIN{while((getline&lt;"file1.txt")&gt;0)l[$1]=$0}$1 in l{print $0"\t"l[$1]}' file2.txt &gt; output.txt</p><p>count number of occurrence of column 2 (uniq -c):</p><p>awk '{l[$2]++}END{for (x in l) print x,l[x]}' input.txt</p><p>apply "uniq" on column 2, only printing the first occurrence (uniq):</p><p>awk '!($2 in l){print;l[$2]=1}' input.txt</p><p>count different words (wc):</p><p>awk '{for(i=1;i!=NF;++i)c[$i]++}END{for (x in c) print x,c[x]}' input.txt</p><p>deal with simple CSV:</p><p>awk -F, '{print $1,$2}'</p><p>substitution (sed is simpler in this case):</p><p>awk '{sub(/test/, "no", $0);print}' input.txt</p><p>&nbsp;</p><p>OK now here's where to read this stuff properly explained. roll</p><p>Two thorough tutorials:</p><p>http://www.gnu.org/software/gawk/manual/gawk.html</p><p>http://www.grymoire.com/Unix/Awk.html</p><p>A famous list of useful one-liners - though they're short, many are quite tricky:</p><p>http://www.pement.org/awk/awk1line.txt</p><p>And some nice explanations of those one-liners. After reading this you'll have a pretty good grasp!</p><p>http://www.catonmat.net/blog/awk-one-li &hellip; -part-one/</p><p>http://www.catonmat.net/blog/ten-awk-ti &hellip; -pitfalls/</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4106/phd-at-national-institute-for-research-in-reproductive-health</guid>
  <pubDate>Fri, 30 Aug 2013 04:50:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[PhD at National Institute for Research in Reproductive Health]]></title>
  <description><![CDATA[
<p>National Institute for Research in Reproductive Health</p>

<p>(Indian Council of Medical Research )<br />Jehangir Merwanji Street, Parel, Mumbai 400 012</p>

<p>Advertisement No. 1/NIRRH/Ph.D. 2013<br />Admission to Ph.D. Programme – 2013</p>

<p>National Institute for Research in Reproductive Health, Mumbai, a premier institute of the Indian Council of Medical Research, conducts basic, clinical and operational research in different areas of reproductive health. The thrust areas of research include: Fertility Regulation, Infertility and Reproductive Disorders, Reproductive Tract Infections, Maternal and Child Health, Osteoporosis, Genetic Disorders, Stem Cell Biology, Structural Biology, Bioinformatics and Reproductive Toxicology. Institute is affiliated to the University of Mumbai for the award of Ph.D. degree in Applied Biology, Biochemistry, Life Sciences and Biotechnology. The institute invites applications from young and bright students for enrollment in Ph.D. programme.</p>

<p>More at http://www.nirrh.res.in/announcements/phd_program_2013.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/2742/baumbach-lab</guid>
  <pubDate>Wed, 21 Aug 2013 10:56:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[Baumbach Lab]]></title>
  <description><![CDATA[
<p>The Computational Biology research group was established in October 2012 at the Department of Mathematics and Computer Science (IMADA) at the University of Southern Denmark (SDU). It emerged from the Computational Systems Biology group, founded in March 2010 at the Max Planck Institute for Informatics (MPII) and the Cluster of Excellence for Multimodel Computing and Interaction (MMCI) at Saarland University, Saarbrücken, Germany.<br />​<br />The group is headed by Prof. Dr. Jan Baumbach and currently hosts nine PhD students and one postdoctoral fellow at both, IMADA/SDU and MMCI/MPII.</p>

<p>More at &gt;&gt; http://www.baumbachlab.net/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2839/look-up-a-biological-numbers</guid>
	<pubDate>Fri, 23 Aug 2013 03:27:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2839/look-up-a-biological-numbers</link>
	<title><![CDATA[Look up a biological numbers]]></title>
	<description><![CDATA[<p><strong>Did you ever need to look up a number</strong><span>&nbsp;like the volume of a cell or the cellular concentration of ATP, only to find yourself spending much more time than you wanted on the Internet or flipping through textbooks - all without much success?&nbsp;</span><br><br><span>Well, it didn&rsquo;t happen only to you. It is often surprising how difficult it can be to find concrete biological numbers, even for properties that have been measured numerous times. To help solve this for one and all, BioNumbers (</span><strong>the database of key numbers in molecular biology</strong><span>) was created. Along with the numbers, you'll find the relevant&nbsp;</span><strong>references to the original literature</strong><span>, useful comments, and related numbers.&nbsp;</span></p>
<p><span><span>To cite BioNumbers please refer to: Milo et al. Nucl. Acids Res. (2010) 38: D750-D753. When using a specific entry from the database it is highly recommended that you also specify the BioNumbers 6 digit ID, e.g. "BNID 100986, Milo et al 2010".&nbsp;</span></span></p><p>Address of the bookmark: <a href="http://bionumbers.hms.harvard.edu/" rel="nofollow">http://bionumbers.hms.harvard.edu/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/3952/ancestor-at-work</guid>
	<pubDate>Sun, 25 Aug 2013 19:45:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/3952/ancestor-at-work</link>
	<title><![CDATA[Ancestor at work !!!]]></title>
	<description><![CDATA[<p>When they will learn Bioinformatics :)</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/3952" length="10064" type="image/gif" />
</item>

</channel>
</rss>