<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29144?offset=1170</link>
	<atom:link href="https://bioinformaticsonline.com/related/29144?offset=1170" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6012/project-junior-research-fellow-ccmb</guid>
  <pubDate>Fri, 01 Nov 2013 10:38:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Junior Research Fellow @ CCMB]]></title>
  <description><![CDATA[
<p>Temporary Project positions available purely on temporary basis - Oct/2013</p>

<p>1. Project Junior Research Fellow / Project Assistant</p>

<p>Last Date: 11th Nov 2013</p>

<p>Qualification B.Tech (Comp. Sci.), B.Tech/M.Tech (Bioinformatics), MCA,  M.Sc. (Mathematics/Statistics)</p>

<p>Desirable Qualifications: Programming in FORTRAN/ C /PERL, Web application technologies</p>

<p>Upper Age limit 28</p>

<p>Rs.12000 / Rs.16000 (as sanctioned by the funding agency)</p>

<p>General terms and conditions:</p>

<p>    Positions are purely temporary and co-terminus with the project.</p>

<p>    HRDG (CSIR) prevailing guidelines are applicable these positions.</p>

<p>    All categories of applicants are required to submit online application.</p>

<p>    Enhancement of stipend to Project JRF to Project SRF will be with the due recommendation of Principal Investigator and approval of the Director on the evaluation of the 3 member Standing Committee consisting of Chairperson at the level of Chief Scientist, Coordinator of the JRFs/RAs/PDFs and the Principal Investigator of the Project.</p>

<p>    The age relaxation as per HRDG (CSIR) norms: SC/ST/OBC/Women/Physically Handicapped persons – five years.</p>

<p>    The Stipend normally be fixed at Rs.22000/- for Research Associates/Post Doc. Fellows. However, a selected RA/PDF may be placed in the higher start of stipend if there is ample justification and such recommendation is made by the Selection Committee. Based on the recommendation with justification by the PI and approval of the Director, person getting stipend at lower rate may be elevated to higher rate subject to availability of the funds in the project.</p>

<p>    Recruitment will be based on initial screening based on qualifications and experience criteria and also based on suitability of the candidates to the nature of research project. This screening will be followed by written test followed / interview. After completing this process, candidates will be shortlisted and appointed in specific project subjects as and when appropriate positions become available. The pool of selected candidates will be valid for six months.</p>

<p>    Remunerations indicate are maximum admissible and will depend upon the availability of funds and subject to conditions applicable to projects from different funding agencies at the time of recruitment.</p>

<p>Apply : http://www.ccmb.res.in/positions/projects/temp_positions.php</p>

<p>Form download : http://www.ccmb.res.in/positions/projects/oct-2013/pdf_download.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6233/edwards-lab</guid>
  <pubDate>Sun, 10 Nov 2013 15:07:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Edwards Lab]]></title>
  <description><![CDATA[
<p>We study the evolutionary biology of birds and relatives, combining field, museum and genomics approaches to understand the basis of avian diversity, evolution and behavior. Our guiding approaches include population genetics, which provides a quantitative framework for studying speciation, geographic variation and genome evolution; systematics, which acknowledges that the focal species of any study has relatives that are behaviorally and ecologically no less interesting; and natural history, which gives meaning to the genes and genomic patterns we study.</p>

<p>Lab page: http://www.oeb.harvard.edu/faculty/edwards/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6559/ai-cadd-project-kerela-university</guid>
  <pubDate>Tue, 19 Nov 2013 17:48:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Ai-CADD Project @ Kerela University]]></title>
  <description><![CDATA[
<p>Applications are invited for the following Positions in the AiCADD project funded by MHRD Govt of India</p>

<p>Last Date for Submitting Application: 25th November 2013</p>

<p>1. Senior Scientist: (01 position)<br />Pay Scale: Rs.40, 000/-<br />Qualifications:  PhD/ Post Doctoral with Experience in CADD</p>

<p>2. Junior Scientist (10 positions)<br />Pay Scale: Rs. 22,000/-<br />Qualifications: MPhil / Masters Degree in Bioinformatics / Computational Biology / CADD / Ayurveda</p>

<p>3. Technical Assistant (01+01 positions)<br />Pay Scale: Rs.12,000/-<br />Qualifications: 1. BSc Computer Science/ MCA<br />Qualifications: 2. MSc Biotechnology / MSc Microbiology </p>

<p>4. Programmer (01 position)<br />Pay Scale: Rs.20,000/-<br />Qualifications: MSc Computer Science/ MCA / B Tech (Experience in MATLAB, C, C++) Industrial experience is desirable</p>

<p>5. Teaching Assistant (03 positions)<br />Pay Scale: Rs.10,000/-<br />Qualifications: MSc in Bioinformatics </p>

<p>6. Administration Assistant (02 positions)<br />Pay Scale: Rs.8,000/-<br />Qualifications: Degree + PGDCA</p>

<p>The Selection process comprises of written test and interview. Positions are purely temporary (initially for the period of one year) and co-terminus with the project. For more details mail to: cbi.uok [at] gmail.com</p>

<p>More detail @ https://sites.google.com/site/centreforbioinformatics/announcements/applicationsinvitedforapplicationforai-caddproject</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6577/scientist-b-vector-control-research-centre</guid>
  <pubDate>Tue, 19 Nov 2013 21:19:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist-B @ VECTOR CONTROL RESEARCH CENTRE]]></title>
  <description><![CDATA[
<p>VECTOR CONTROL RESEARCH CENTRE<br />(Indian Council of Medical Research)<br />Indira Nagar Medical Complex<br />Puducherry-605006</p>

<p>WALK-IN-INTERVIEW</p>

<p>The following vacancies shall be filled purely on adhoc basis under Non-Institutional adhoc project “Bioinformatics in ICMR Institutes” funded by Indian Council of Medical Research at Vector Control Research Centre, Puducherry, to be renewed annually and filled through Walk-in-Interview as indicated below. Candidates who wish to appear for the Walk-in-Interview can download the application format given in the website of Vector Control Research Centre (www.vcrc.res.in). Duly filled in application along with attested copies of certificate should be submitted at time of interview.</p>

<p>Date &amp; Time : 05.12.2013 at 9.00 AM – Scientist-C (Non-Medical)</p>

<p>05.12.2013 at 1.30 PM – Scientist-B (Non-Medical)<br />06.12.2013 at 9.00 AM – Technical Assistant (Research Assistant)<br />06.12.2013 at 1.30 PM – Multi Tasking Staff (General)</p>

<p>Place : Vector Control Research Centre, Puducherry</p>

<p>Project entitled : Biomedical Informatics Centres of ICMR</p>

<p>1. Scientist - C (Non-Medical) Number of post – ONE</p>

<p>Essential qualification</p>

<p>B.E./ B. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University with 6 years experience in the relevant field  OR</p>

<p>First class Master’s Degree and Ph.D. Degree in Bioinformatics/ Computational Biology from a recognized University OR</p>

<p>First class Master’s Degree in Bioinformatics/ Computational Biology from a recognized University with 4 years R &amp; D experience in the related subjects as mentioned above OR</p>

<p>Second class Master’s Degree + Ph.D. in Bioinformatics/ Computational Biology from a recognized University with 4 years research experience in bio-medical subjects</p>

<p>Age: Not exceeding 40 years Consolidated Salary – Rs.39,960/- p.m. + HRA as<br />admissible </p>

<p>Desirable qualification (i) Post-doctorate in Bioinformatics/ Computational Biology or M.E. / M. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University for candidates with First Class relevant degree.</p>

<p>(ii) Additional post-doctoral research / teaching experience in Bioinformatics/Computational Biology in recognized Institute(s).</p>

<p>(iii) Knowledge of computer applications or data management</p>

<p>Job requirements i) To apply Bioinformatics / Computational Biology tools in understanding interactions between vectors and parasites/ pathogens and target based development of drug / insecticides.</p>

<p>ii) To assist the investigators to carry out genomic studies on parasites/pathogens/vectors of vector borne diseases</p>

<p>Advertisement: http://vcrc.res.in/Adv_Bio13.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6835/roslin-bioinformatics-group</guid>
  <pubDate>Mon, 25 Nov 2013 23:55:25 -0600</pubDate>
  <link></link>
  <title><![CDATA[Roslin Bioinformatics Group]]></title>
  <description><![CDATA[
<p>Roslin Bioinformatics Group</p>

<p>The Law group provides internal Institute-specific development, training and support roles for data manipulation, sequence analysis and any other aspect of the analysis of biological data using computer systems. Additionally we provide databases and applications supporting the international animal science community, particularly tools and resources for genome mapping.</p>

<p>Head: Andy Law. Members: John Bowman (animal facility database applications), Zen Lu (bioinformatics support), Trevor Paterson (software development)</p>

<p>More @ http://www.bioinformatics.ed.ac.uk/groups/roslin-bioinformatics-group</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7569/phd-at-university-of-calgary</guid>
  <pubDate>Fri, 27 Dec 2013 20:24:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[PhD at University of Calgary]]></title>
  <description><![CDATA[
<p>Institution/Company: <br />University of Calgary<br />Location: <br />Calgary, AB<br />Job Description: </p>

<p>Novel diagnostic platform for detection of Osteoarthritis</p>

<p>I invite applications from highly motivated individuals to join my laboratory as a PhD student in Systems Biology at the University of Calgary McCaig Institute for Bone and Joint Health. This project is aimed at characterizing the networks of physical (protein-protein) interactions underlying inflammatory processes in patients with Osteoarthritis and how this differs from patients with Rheumatoid Arthritis and normal individuals. This work will eventually lead to the development of a novel diagnostic platform for the non-invasive and accurate detection of early Osteoarthritis. The selected candidate will use state-of-the-art computational methodologies to systematically analyze proteomic data, and develop /implement new algorithms to identify protein and functional interaction networks from high throughput experimental data. The individual will also benefit by working closely with experts at the UofC and UofA through an AIHS Alberta Osteoarthritis Team Grant which includes experts from all pillars of health research. The candidate will also be supported to attend bioinformatics workshops and conferences to advance and disseminate their research.<br />Qualifications: The ideal candidate will have a Master’s degree in Computational Biology, Bioinformatics, or equivalent with strong background knowledge of the Biological Sciences, Biochemistry, and Microbiology. The individual should additionally have experience in handling high-throughput data sets as well as programming skills. The candidate will be registered as a PhD student in Dr. Krawetz’s laboratory, located in the new state-of-the-art Health Research Innovation Centre at the UofC. The individual will have strong verbal and written skills and the ability to work efficiently in a team environment.</p>

<p>In addition to the outstanding research opportunities available in this setting, students also enjoy the many cultural and sporting amenities provided in the city of Calgary, and can take advantage of the unparalleled skiing and hiking in the Rocky Mountains that are less than an hour away.</p>

<p>Candidates must be academically competitive and will be expected to apply for external funding. The stipend is $25,000/yr. For outstanding PhD students, internal top-up award opportunities are available on a competitive basis. If interested in joining the lab, please contact Dr. Krawetz directly at rkrawetz@ucalgary.ca and provide the following information:</p>

<p>- Short cover letter explaining your interest in the lab<br />- Resume<br />- Scanned copy of transcript or listing of course grades<br />- Names and contact information for two individuals who will be willing to provide letters of reference</p>
]]></description>
</item>

</channel>
</rss>