• Using state of the art tools, easily extended for other viruses

• Tool and database updates for critical components via Conda

• Built using modern design patterns with Conda and Snakemake

• Extensible and easy to customize

• Submission Ready Genomes

• Customizable reporting with comprehensive visualization

https://ikim-essen.github.io/uncovar/

Github https://github.com/IKIM-Essen/uncovar

Address of the bookmark: https://ikim-essen.github.io/uncovar/

The Power of Evo 2: AI Meets DNA

Evo 2 is the largest AI model for biology ever created, trained on an astonishing 9.3 trillion DNA "letters" (nucleotides) carefully selected from genomes spanning the entire tree of life. This massive dataset ensures that Evo 2 can recognize patterns and relationships in genetic sequences at an unparalleled scale.

For the first time, scientists can design DNA with AI, moving beyond simple sequence analysis to active DNA generation. Evo 2 enables researchers to predict, modify, and even create entire genetic sequences, opening new possibilities in medicine, agriculture, and synthetic biology.

Decoding the Dark Genome

One of the biggest challenges in genetics is understanding the non-coding regions of DNA—vast stretches of the genome that do not code for proteins but play crucial roles in regulating gene expression. These regions control when and how genes are activated, influencing everything from development to disease.

Evo 2 is designed to decode these non-coding elements, helping researchers uncover their functions and use this knowledge to develop gene-based therapies, synthetic life forms, and precision agriculture solutions.

From Reading DNA to Writing It

To put Evo 2’s impact into perspective:

• Previous AI models could "read" DNA like a book, analyzing genetic sequences and identifying patterns.
• Evo 2 can "write" entirely new DNA, designing functional genes, chromosomes, and even full genomes from scratch.

This means scientists can now engineer biological systems with AI, designing new proteins, metabolic pathways, and genetic circuits to address real-world challenges.

A Step Toward Generative Biology

The Arc Institute describes Evo 2 as a major step toward "generative biology"—a revolutionary approach where AI is used to create novel biological structures rather than just analyzing existing ones. This could lead to breakthroughs such as:

• New medicines: AI-generated enzymes and proteins tailored for targeted therapies.
• Disease-resistant crops: Genetically optimized plants for higher yield and climate resilience.
• Synthetic organisms: Custom-designed microbes for bioremediation, biofuel production, and industrial applications.

An Open-Source Revolution

Unlike many proprietary AI models, Evo 2 is open source, making its capabilities accessible to researchers worldwide. This democratization of AI-driven biology means that scientists from different disciplines can collaborate, experiment, and innovate, accelerating discoveries in genetic engineering and synthetic biology.

With Evo 2, the boundaries of what’s possible in DNA design, genetic engineering, and biological innovation are being redrawn. The future of life sciences is no longer just about understanding life’s code—it’s about writing it.

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

That is the challenge researchers face when studying how bacteria adapt to different environments. A bacterial gene may appear to be linked to a particular habitat, when the real reason is simply that closely related bacteria happen to live there.

In their 2025 Genome Biology paper, Bujdoš, Walter, and O’Toole introduce aurora, a machine-learning tool designed to tackle this problem.

Aurora identifies potentially mislabeled or unusual bacterial strains before performing genome-wide association studies (GWAS). By cleaning up the dataset and accounting for bacterial evolutionary relationships, it can help researchers find genetic features that are more genuinely connected to habitat adaptation.

The researchers tested aurora using simulated and real bacterial datasets and found that it could recover important genetic associations even when datasets contained misleading labels.

The bigger lesson is simple: better biological discoveries often begin with better data.

Aurora gives researchers a new way to separate real genetic clues from misleading ones—and could help us better understand how bacteria adapt, survive, and evolve in the environments they call home.

Based on Bujdoš et al., “aurora: a machine learning GWAS tool for analyzing microbial habitat adaptation,” Genome Biology (2025).[Read the original paper](https://link.springer.com/article/10.1186/s13059-025-03524-7?)

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Research Directions

Stony corals: evolution of novelty and photosymbiosis

Symbiotic acoels: cell type evolution and photosymbiosis

Animal genomes: structural evolution and gene regulation

https://sgel.biodiv.tw/home

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Address of the bookmark: http://www.phrap.org/consed/consed.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}