<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29210?offset=1440</link>
	<atom:link href="https://bioinformaticsonline.com/related/29210?offset=1440" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12582/postdoc-position-at-centre-mediterraneen-de-medecine-moleculaire</guid>
  <pubDate>Sun, 06 Jul 2014 11:23:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Centre Méditerranéen de Médecine Moléculaire]]></title>
  <description><![CDATA[
<p>The research group of Dr. Michele Trabucchi at the Centre Méditerranéen de Médecine Moléculaire (C3M) at INSERM U1065 (University of Nice Sophia-Antipolis, France) is seeking candidates for a Postdoctoral fellow position to start on October 2014 for 3 years funded by FRM (Fondation pour la Recherche Médicale).<br />The broad interest of the lab is in understanding the expression control and function of small RNAs in activated myeloid cells (visit our webpage to check research interests and publications of the group : http://www.unice.fr/c3m/EN/Equipe10.html ). </p>

<p>The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.<br /> <br />Candidates should hold a Ph.D. degree and have strong background in bioinformatics.<br />The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.<br />Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/14218/pimp-your-brain-bioinformatics</guid>
	<pubDate>Wed, 20 Aug 2014 22:09:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/14218/pimp-your-brain-bioinformatics</link>
	<title><![CDATA[Pimp your brain: Bioinformatics]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/KqelGy6Q8nE" frameborder="0" allowfullscreen></iframe>Jan Lisec from the Max Planck Institute of Molecular Plant Physiology explains, in this "pimp your brain" episode, what bioinformatics is and why bioinformatics is so important and indispensable for biological research.

In the video serial "Pimp your brain" scientists from the Max Planck Institute of Molecular Plant Physiology describe their research. More videos from the 'Pimp your brain' serial are available on www.youtube.com/playlist?list=PL-l9VItC9Gn2Ur2Xj6PTOAkjLUlVPbIOO

More videos are available on www.mpimp-golm.mpg.de]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12989/center-for-molecular-dynamics-nepal-cmdn-nepal</guid>
  <pubDate>Wed, 23 Jul 2014 13:54:51 -0500</pubDate>
  <link></link>
  <title><![CDATA[Center for Molecular Dynamics Nepal (CMDN), Nepal]]></title>
  <description><![CDATA[
<p>Center for Molecular Dynamics Nepal (CMDN), established 2007 prides itself as a research driven nongovernmental organization. Unlike other civil society organizations, CMDN is dedicated entirely to promoting research in the country. With its team of energetic and highly motivated experts, CMDN is now recognized as the leading public health and wildlife research organization of the country.</p>

<p>More at http://www.cmdn.org.np/main/index.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/13267/the-genome-10k-project</guid>
	<pubDate>Tue, 29 Jul 2014 09:11:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/13267/the-genome-10k-project</link>
	<title><![CDATA[The Genome 10K Project]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/B57xDIGtCT0" frameborder="0" allowfullscreen></iframe>https://genome10k.soe.ucsc.edu

The Genome 10K project aims to assemble a genomic zoo—a collection of DNA sequences representing the genomes of 10,000 vertebrate species, approximately one for every vertebrate genus. The trajectory of cost reduction in DNA sequencing suggests that this project will be feasible within a few years. Capturing the genetic diversity of vertebrate species would create an unprecedented resource for the life sciences and for worldwide conservation efforts.

The growing Genome 10K Community of Scientists (G10KCOS), made up of leading scientists representing major zoos, museums, research centers, and universities around the world, is dedicated to coordinating efforts in tissue specimen collection that will lay the groundwork for a large-scale sequencing and analysis project.]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13477/research-associate-at-indian-institute-of-chemical-technology-iict-hyderabad</guid>
  <pubDate>Thu, 07 Aug 2014 01:55:21 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate at Indian Institute of Chemical Technology (IICT), Hyderabad]]></title>
  <description><![CDATA[
<p>Indian Institute of Chemical Technology (IICT), Hyderabad, a constituent of CSIR is a leading research Institute in the area of chemical sciences. The core strength of IICT lies in Organic Chemistry, and it continues to excel in this field for over six decades. The research efforts during these years have resulted in the development of several innovative processes for a variety of products necessary for human welfare such as drugs, agrochemicals, food, organic intermediates, adhesives etc. More than 150 technologies developed by IICT are now in commercial production.</p>

<p>CSIR-IICT is conducting Walk in Interview for the following position on a purely temporary basis for the sponsored project "GENESIS (BSC-0121) at 10.00 AM on 19th August 2014 at IICT, Hyderabad</p>

<p>    Position : Research Associate<br />    No of Post : One<br />    Desired Profile : PhD in computation biology or M.Tech in Computational Biology with three years experience in relevant subject and atleast one research paper in SCI journal</p>

<p>    Experience : Knowledge in vector and vector borne disease, disease modeling, GIS mapping and modeling.<br />    Age : 35 years<br />    Stipend : Rs 22000/- + HRA</p>

<p>Eligible candidate may download the application form from our website http://www.iictindia.org and appear for interview along with the duly filled in application form supported by bio-data and one set of attested photo copies of certificates of educational qualification, age, experience, caste, latest photograph and the cadndidates are required to bring all the original certificates for verification</p>

<p>Walk in Interview : 19.08.14</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14003/jrf-position-in-the-faculty-of-life-sciences-biotechnology-at-sauth-asian-university</guid>
  <pubDate>Wed, 13 Aug 2014 07:16:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF position in the Faculty of Life Sciences &amp; Biotechnology at  Sauth Asian University]]></title>
  <description><![CDATA[
<p>Opening for a Project-JRF position in the Faculty of Life Sciences &amp; Biotechnology</p>

<p>Applications are invited for the post of Junior Research Fellow (JRF) in a DBT funded IYBA project entitled “Generatingaprotein-ncRNA interactome for Dorsal mediated gene regulation and dorso-ventral patterning genes in Drosophila” in the Lab. Of Molecular Biology at the Faculty of Life Sciences and Biotechnology, South Asian University, New Delhi. The project requires extensive use of molecular, genetic and genomic approaches.</p>

<p>POST: Junior Research Fellow (JRF)</p>

<p>NO. OF VACANCIE(S) - (01)</p>

<p>FELLOWSHIP: Rs. 16,000/- plus HRA</p>

<p>PROJECT DURATION: 2014-2016 (Two years)</p>

<p>LAST DATE FOR APPLICATION: Aug 18, 2014.</p>

<p>Eligibility criteria:</p>

<p>M.Sc./M.Tech./ in Biological Sciences/Biotechnology/Bio-Informatics. Candidates with research experience in the field of Drosophila/Yeast genetics will be preferred.</p>

<p>Application Procedure:</p>

<p>A covering letter along with your CV, copy of prior publications (if any) and proof of experience should be e-mailed to lmb_sau@aol.com. Hardcopy of the application should be brought on the day of interview along with other testimonials and marks statements for verification purpose.</p>

<p>IMPORTANT NOTE:</p>

<p>-No TA/DA will be paid for attending the interview.</p>

<p>-SAU may select candidates against the post depending upon qualification and experience of candidates and reserves the right to relax any of the qualifications in case the candidate is found otherwise well qualified by the Selection Committee</p>

<p>-The abovementioned post is temporary and will be initially offered for a period of one year and can be extended, on satisfactory performance. </p>

<p>More at http://www.sau.ac.in/recruitment/vacancy.html</p>
]]></description>
</item>

</channel>
</rss>