<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29272?offset=630</link>
	<atom:link href="https://bioinformaticsonline.com/related/29272?offset=630" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12868/landry-lab</guid>
  <pubDate>Thu, 17 Jul 2014 14:33:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Landry Lab]]></title>
  <description><![CDATA[
<p>EVOLUTIONARY AND INTEGRATIVE CELL BIOLOGY</p>

<p>Our research is at the crossroad between cell biology, ecological genomics, systems biology, molecular evolution and population genetics. We study the architecture and evolution of protein and signalling networks.</p>

<p>More at http://landrylab.ibis.ulaval.ca/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8970/j-aires-de-sousa-research-group</guid>
  <pubDate>Wed, 12 Mar 2014 09:57:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[J. Aires de Sousa Research Group]]></title>
  <description><![CDATA[
<p>We are involved in the development of methods and software in chemoinformatics. Current main projects are:</p>

<p>1.automatic learning of chemical reactivity and metabolism,<br />2.simulation of NMR spectra,<br />3.modelling of properties of ionic liquids, and<br />4.representation of molecular chirality.</p>

<p>More at http://joao.airesdesousa.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</guid>
	<pubDate>Thu, 13 Mar 2014 17:16:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</link>
	<title><![CDATA[Linux SSH Client Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Here come on let play with the following basic command line usage of the ssh client.<br /><br /><strong>1. Check your SSH Client Version:</strong><br /><br />Checking for your SSH client is very sare, but sometimes it may be necessary to identify the SSH client that you are currently running and it&rsquo;s corresponding version number. The SSh client can be identified as follows<br /><br />$ ssh -V<br />OpenSSH_3.9p1, OpenSSL 0.9.7a Feb 19 2013<br /><br />$ ssh -V<br />ssh: SSH Secure Shell 3.2.9.1 (non-commercial version) on i686-pc-linux-gnu<br /><br /><strong>2. Connect and login to remote host:</strong></p><p>The First time when you login to the remotehost from a localhost, it will display the host key not found message and you can give &ldquo;yes&rdquo; to continue. The host key of the remote host will be added under .ssh2/hostkeys directory of your home directory, as shown below.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit@remotehost.example.com password:</p><p>remotehost.example.com$</p><p>The Second time when you login to the remote host from the localhost, it will prompt only for the password as the remote host key is already added to the known hosts list of the ssh client.<br /><br />localhost$ ssh -l jit remotehost.example.com<br />jit@remotehost.example.com password: <br />remotehost.example.com$<br /><br />For some reason, if the host key of the remote host is changed after you logged in for the first time, you may get a warning message as shown below. This could be because of various reasons such as 1) Sysadmin upgraded/reinstalled the SSH server on the remote host 2) someone is doing malicious activity etc., The best possible action to take before saying &ldquo;yes&rdquo; to the message below, is to call your sysadmin and identify why you got the host key changed message and verify whether it is the correct host key or not.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit @remotehost.example.com's password: <br />remotehost$<br /><br /><strong>4. Debug SSH Client:</strong><br /><br />Sometimes it is necessary to view debug messages to troubleshoot any SSH connection issues. For this purpose, pass -v (lowercase v) option to the ssh as shown below.<br /><br />Example without debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$ ssh -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to the name<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$</p><p>Example with debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; locaclhost$ ssh -v -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:2838/ssh2_parse_config_ext: Metaconfig parsing stopped at line 3.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:637/ssh_config_set_param_verbose: Setting variable 'VerboseMode' to 'FALSE'.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:3130/ssh_config_read_file_ext: Read 17 params from config file.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Ssh2/ssh2.c:1707/main: User config file not found, using defaults. (Looked for '/home/jit/.ssh2/ssh2_config')<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Connecting to remotehost.example.com, port 22... (SOCKS not used)<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to</p><p><strong>5. Escape Character: (Toggle SSH session, SSH session statistics etc.)</strong><br /><br />Escape character ~ get&rsquo;s SSH clients attention and the character following the ~ determines the escape command.<br />Toggle SSH Session: When you&rsquo;ve logged on to the remotehost using ssh from the localhost, you may want to come back to the localhost to perform some activity and go back to remote host again. In this case, you don&rsquo;t need to disconnect the ssh session to the remote host. Instead follow the steps below.</p><p>i. Login to remotehost from localhost: localhost$ssh -l jit remotehost<br />ii. Now you are connected to the remotehost: remotehost$<br />iii. To come back to the localhost temporarily, type the escape character ~ and Control-Z. When you type ~ you will not see that immediately on the screen until you press and press enter. So, on the remotehost in a new line enter the following key strokes for the below to work: ~<br /><br />&nbsp;&nbsp;&nbsp; remotehost$ ~^Z<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; localhost$</p><p>iv. Now you are back to the localhost and the ssh remotehost client session runs as a typical unix background job, which you can check as shown below:<br /><br />&nbsp;&nbsp;&nbsp; localhost$ jobs<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br /><br />v. You can go back to the remote host ssh without entering the password again by bringing the background ssh remotehost session job to foreground on the localhost<br /><br />&nbsp;&nbsp;&nbsp; localhost$ fg %1<br />&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; remotehost$</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/9213/basic-notions-in-molecular-biology-and-genetics</guid>
	<pubDate>Sun, 16 Mar 2014 18:15:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/9213/basic-notions-in-molecular-biology-and-genetics</link>
	<title><![CDATA[Basic Notions in Molecular Biology and Genetics]]></title>
	<description><![CDATA[<p>This is a presentation about some fundamental concepts applied in molecular biology and genetics, also it contains a little bit of the experience that one of our members has gained in his years of undergraduate state related to molecular cloning. Our research group, called "BIOPHARM" (Acronymus of Laboratory of Bioinformatics and Pharmacogenetics), was stablished on 2007, took it a bit of years to make it real this initative, although, nowadays, we're working on some projects involved in those fields. This research group belongs to the Department of Biochemistry, Faculty of Pharmacy and Biochemistry, Universidad Nacional Mayor de San Marcos, Lima, Per&uacute;. We try to encourage research initiatives, helping them and also we use to participate in differents courses, congress and symposiums.</p>]]></description>
	<dc:creator>Antony Campos</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/9213" length="2962422" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/9341/gerstein-lab</guid>
  <pubDate>Wed, 19 Mar 2014 12:48:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[Gerstein Lab]]></title>
  <description><![CDATA[
<p>The focus of the Gerstein Lab is interpreting personal genomes, particularly in relation to disorders, such as cancer. This endeavor has a number of related aspects described below. Moreover, the approaches we take have broad connections to a variety of data-intensive fields, within the emerging discipline of data science. </p>

<p>Personal Genome Variation: SVs<br />Human Genome Annotation: Processing Next-Gen Sequencing Data<br />Comparative Genomics: Pseudogenes as Molecular Fossils<br />Protein Structure and Function: Macromolecular Motions<br />Analysis of Diverse Networks<br />Genomics at the Forefront of Data Science</p>

<p>Lab page: http://www.gersteinlab.org/</p>
]]></description>
</item>

</channel>
</rss>