<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29274?offset=350</link>
	<atom:link href="https://bioinformaticsonline.com/related/29274?offset=350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</guid>
	<pubDate>Tue, 24 Jun 2014 07:58:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</link>
	<title><![CDATA[Genomic Medicine - Bruce Korf (2014)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/FYldIrsXHKw" frameborder="0" allowfullscreen></iframe>May 21, 2014 - Current Topics in Genome Analysis 2014
A lecture series covering contemporary areas in genomics and bioinformatics. More: http://www.genome.gov/COURSE2014]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12594/faculty-positions-at-central-university-of-punjab</guid>
  <pubDate>Mon, 07 Jul 2014 23:33:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty Positions at Central University of Punjab]]></title>
  <description><![CDATA[
<p>Faculty Positions: Rolling/Open Advertisement Advt.No: T-10 (2013)</p>

<p>Pay Scale: Pay Band Rs.15600-39100 with AGP of Rs.6,000/-</p>

<p>Essential Qualifications for Professors, Associate Professors, and Assistant Professors: As per “UGC REGULATIONS ON MINIMUM QUALIFICATIONS FOR APPOINTMENT OF TEACHERS AND OTHER ACADEMIC STAFF IN UNIVERSITIES AND COLLEGES AND MEASURES FOR THE MAINTENANCE OF STANDARDS IN HIGHER EDUCATION 2010“ and the 2nd Amendments to the regulation issued in June 2013.</p>

<p>For details: http://www.ugc.ac.in/oldpdf/regulations/revised_finalugcregulationfinal10.pdf http://www.ugc.ac.in/pdfnews/8539300_English.pdf and University rules.</p>

<p>Procedure to apply:</p>

<p>Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 500/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:</p>

<p>Registrar, Central University of Punjab, City Campus, Mansa Road, Bathinda-151001</p>

<p>For more info visit: http://www.centralunipunjab.com/Teaching/Final%20Details-t10-2013.pdf, http://www.centralunipunjab.com/Teaching/Advertisement-t10-2013.jpg</p>

<p>Last Apply Date: 31 Dec 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/12787/integrative-genomics-viewer-igv-tutorial</guid>
	<pubDate>Sat, 12 Jul 2014 15:16:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/12787/integrative-genomics-viewer-igv-tutorial</link>
	<title><![CDATA[Integrative Genomics Viewer (IGV) tutorial]]></title>
	<description><![CDATA[<p>The <a href="http://www.broadinstitute.org/igv/">Integrative Genomics Viewer (IGV)</a> from the Broad Center allows you to view several types of data files involved in any NGS analysis that employs a reference genome, including how reads from a dataset are mapped, gene annotations, and predicted genetic variants.</p>
<p>http://www.broadinstitute.org/igv/</p><p>Address of the bookmark: <a href="https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial" rel="nofollow">https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/12963/cosmos-our-workflow-management-system-for-ngs-data</guid>
	<pubDate>Wed, 23 Jul 2014 07:29:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/12963/cosmos-our-workflow-management-system-for-ngs-data</link>
	<title><![CDATA[COSMOS, our workflow management system for NGS data]]></title>
	<description><![CDATA[<p><strong>COSMOS</strong>, our Python-based management system for implementing large-scale parallel workflows focusing on, but not restricted to, large-scale short-read "NGS" sequencing data is open-access published via <a href="http://bioinformatics.oxfordjournals.org/content/early/2014/06/29/bioinformatics.btu385.abstract">Advance Access</a> in <em>Bioinformatics</em> (<a href="http://scholar.harvard.edu/lancaster/publications/cosmos-python-library-massively-parallel-workflows">Gafni et al. 2014</a>).&nbsp; It is also available for download for non-commercial academic and research purposes at:</p>
<p><strong>&nbsp;<a href="http://cosmos.hms.harvard.edu/">http://cosmos.hms.harvard.edu/</a></strong>.</p><p>Address of the bookmark: <a href="https://cosmos.hms.harvard.edu/" rel="nofollow">https://cosmos.hms.harvard.edu/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12995/national-center-for-bioinformatics-ncb</guid>
  <pubDate>Wed, 23 Jul 2014 14:10:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Center for Bioinformatics (NCB)]]></title>
  <description><![CDATA[
<p>NCB is offering M.Phil and Ph.D programs in the area of Bioinformatics. The major goal of NCB is to promote quality training and research in the area of Bioinformatics. Bioinformatics originated as a cross-disciplinary field as the need for computational sections to research problem raised in biomedicine. </p>

<p>More at http://ncb.qau.edu.pk/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13276/senior-research-fellow-at-nit-rourkela</guid>
  <pubDate>Wed, 30 Jul 2014 00:53:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow at NIT, Rourkela]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, ROURKELA – 769 008(ORISSA)<br />SPONSORED RESEARCH, INDUSTRIAL CONSULTANCY &amp; CONTINUING EDUCATION</p>

<p>ADVERTISEMENT NO: NITR/SR/CH-BIF/2014/30</p>

<p>Applications are invited on prescribed format for the following assignment in a purely time bound research project undertaken in the Department of Biotechnology &amp; Medical Engineering of the Institute.</p>

<p>1. Name of the Temporary Post : Senior Research Fellow-01<br />2. Name of the Research Project: “ Bioinformatics Infrastructure Facility (BIF)”<br />3. Name of the Sponsoring Agency: DBT, Government of India, 4 Tenure of the Project : 12th Five year Plan<br />5 Tenure of the Assignment : 01 year [Likely to be extended for 04 more years]<br />6 Job Description : BIF Maintenance and Active Research in Bioinformatics<br />7. Consolidated monthly compensation / Fellowship: Rs.18,000/- P.M.</p>

<p>8. Essential Qualifications and experience: B.Tech with valid GATE Score or M.Tech degree in Biotechnology/Bioinformatics/Computer Science/Computational Biology<br />9. Desirable Qualifications/ Experiences: Experience of Programming in PERL,R, Python, Unix and Visual Studio + Knowledge in NGS data analysis work flows ,WGS and statistical packages such as CRAN-R,MATLAB etc.</p>

<p>10. Accommodation : Bachelor accommodation in the Institute may be provided subject to availability.<br />11. For technical information on the project, the candidate may contact the Principal Investigator at the following address:</p>

<p>Name : Prof. Mukesh K Gupta<br />Address : Dept. of Biotechnology &amp; Medical Engineering,<br />N.I.T.Rourkela-769 008<br />Telephone No : 0661-2462294<br />E-mail : guptam@nitrkl.ac.in</p>

<p>Eligible persons may apply in the prescribed format (available in the Institute Website)affixed with coloured photographs to be submitted in duplicate along with photo copies of relevant certificates, grade/ mark sheets, publications etc., to Asst. Registrar, SRICCE,<br />National Institute of Technology, Rourkela–769 008 before 22.08.2014. The cover should be super- scribed clearly the post applied for &amp; Name of the Project.</p>

<p>Mere possession of minimum qualification does not guarantee invitation to the interview.<br />Candidates will be short listed based on merit and need of the project.</p>

<p>Advertisement:</p>

<p>http://www.nitrkl.ac.in/IntraWeb/Jobs_Tenders/Jobs/ProjectFellowship/2014/141707192838_1.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>