https://wlcb.oit.uci.edu/modules/index.html

Address of the bookmark: https://wlcb.oit.uci.edu/NG-Circos

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

SynVisio requires two files to run:

• The simplified gff file that was used as an input for a McScanX query.
• The collinearity file generated as an output by McScanX for the same input query.
• Optional track file in bedgraph format to annotate the generated charts.

SynVisio offers different types of visualizations such as Linear Parallel plots, Hive plots, Stacked Parallel Plots and Dot plots. Users can configure the type of plots required and then choose the source and the target chromosomes that need to be mapped. Users also have option to download the generated visualizations in publication ready SVG or PNG formats.

Address of the bookmark: https://synvisio.github.io/#/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Address of the bookmark: http://catchenlab.life.illinois.edu/chromonomer/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://github.com/schneebergerlab/syri

Dot supports the output of MUMmer’s nucmer aligner the most commonly used software method for aligning genome assemblies. A quick script called DotPrep.py converts the delta file to a more streamlined coordinates file with an index that enables Dot to read in more alignments in certain regions on demand.

Dot, an interactive viewer for genome-genome comparison

https://dnanexus.github.io/dot/

Address of the bookmark: https://github.com/dnanexus/dot

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83