<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29280?offset=980</link>
	<atom:link href="https://bioinformaticsonline.com/related/29280?offset=980" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11175/next-generation-sequencingngs-books</guid>
	<pubDate>Fri, 30 May 2014 04:48:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11175/next-generation-sequencingngs-books</link>
	<title><![CDATA[Next generation sequencing(NGS) books]]></title>
	<description><![CDATA[<p>Employing different technologies, the purpose of NGS platform is to decode the identity or modification on the nucleotides. NGS platforms evolve quickly and capture the main stream.</p>
<p>This bookmark is created to provide NGS online books links.</p><p>Address of the bookmark: <a href="http://en.wikibooks.org/wiki/Next_Generation_Sequencing_%28NGS%29/Print_version" rel="nofollow">http://en.wikibooks.org/wiki/Next_Generation_Sequencing_%28NGS%29/Print_version</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/23590/will-minion-nanopore-sequencing-increase-the-number-of-next-generation-sequencing-projects</guid>
	<pubDate>Tue, 04 Aug 2015 05:14:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/23590/will-minion-nanopore-sequencing-increase-the-number-of-next-generation-sequencing-projects</link>
	<title><![CDATA[Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?]]></title>
	<description><![CDATA[<p>Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?</p>]]></description>
	<dc:creator>Strand</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32875/finishing</guid>
	<pubDate>Sat, 20 May 2017 15:50:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32875/finishing</link>
	<title><![CDATA[Finishing !!]]></title>
	<description><![CDATA[<p>The process of&nbsp;<em>finishing</em>&nbsp;a genome and moving it from a&nbsp;<em>draft</em>&nbsp;stage (the result of sequencing and initial assembly) to a complete genome is typically a time and resource intensive task. The advent of new sequencing technologies has come with its own set of opportunities and pitfalls in the finishing process. While genomes can now be sequenced to high redundancy in a cost-effective manner, the process of assembling the genomes is more challenging and often draft genomes are fragmented into hundreds of contigs. Correspondingly, the task of producing the complete genome can involve months of lab work and thousands of finishing experiments and is usually done in large genome centers.</p>
<p>The work in our lab has focussed on computational approaches to speed-up the finishing process. Specifically, we have explored the use of optical mapping and mate-pair data to augment assemblies and direct finishing experiments. The tools developed in our lab have been used in several finishing projects, producing complete genomes (and near-complete ones) with surprisingly little computational and experimental effort (Nagarajan et al., in submission). The executables (as well as source code) for these tools are freely available here:</p>
<ul>
<li><strong>Scaffolding using Optical Restriction Mapping</strong><br>Optical Maps are global, ordered maps of restriction site locations in a genome. This information can be quite useful in scaffolding contigs from a shotgun assembly to guide the finishing process. A set of programs to exploit optical maps for assembly can be found here:&nbsp;<a href="http://www.cbcb.umd.edu/finishing/soma-v2.tar.gz">SOMA v2.0 (63 MB tar.gz file)</a>. This version of SOMA contains several improvements to programs in v1.0 as well as new scripts for working with multiple maps, contig graphs and scaffolds.&nbsp;<br><br></li>
<li><strong>Augmenting assemblies with mate-pair data</strong><br>Mate-pair information can be valuable in augmenting short-read assemblies and reconstructing the genome as larger scaffolds. AMOS-Hybrid is a pipeline written in the AMOS framework (open-source assembly tools) to merge arbitrary mated reads into an existing assembly and merge contigs and create scaffolds where possible. Source code and executables for AMOS-Hybrid are available here:&nbsp;<a href="http://www.cbcb.umd.edu/finishing/AMOS-Hybrid-v1.tar.gz">AMOS-Hybrid v1.0 (142 MB tar.gz file)</a>.&nbsp;<br><br></li>
<li><strong>Assembly and sequence-composition guided finishing</strong><br>Contigs from a shotgun assembly are typically linked together in a graph structure that can serve to guide finishing and in some case close gaps&nbsp;<em>in-silico</em>. Also, in many cases, sequence composition of contigs can provide clues to fill gaps in scaffolds. A set of scripts to automate some of these tasks can be found here:&nbsp;<a href="http://www.cbcb.umd.edu/finishing/finishing-v1.tar.gz">Finishing Scripts v1.0 (63 MB tar.gz file)</a>.&nbsp;</li>
</ul>
<p>http://www.cbcb.umd.edu/finishing/</p><p>Address of the bookmark: <a href="http://www.cbcb.umd.edu/finishing/" rel="nofollow">http://www.cbcb.umd.edu/finishing/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34493/plast-a-fast-accurate-and-ngs-scalable-bank-to-bank-sequence-similarity-search-tool</guid>
	<pubDate>Fri, 01 Dec 2017 04:10:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34493/plast-a-fast-accurate-and-ngs-scalable-bank-to-bank-sequence-similarity-search-tool</link>
	<title><![CDATA[PLAST: A fast, accurate and NGS scalable bank-to-bank sequence similarity search tool]]></title>
	<description><![CDATA[<p><strong>PLAST is a fast, accurate and NGS scalable bank-to-bank sequence similarity search tool providing significant accelerations of seeds-based heuristic comparison methods, such as the Blast suite of algorithms.</strong></p>
<p><strong>Relying on unique software architecture, PLAST takes full advantage of recent multi-core personal computers without requiring any additional hardware devices.</strong></p>
<p>PLAST stands for&nbsp;<em>Parallel Local Sequence Alignment Search Tool&nbsp;</em>and is was&nbsp;<a href="http://www.biomedcentral.com/1471-2105/10/329" target="_blank">published in BMC Bioinformatics.</a></p>
<p>PLAST is a general purpose sequence comparison tool providing the following benefits:</p>
<ul>
<li>PLAST is a high-performance sequence comparison tool designed to compare two sets of sequences (query vs. reference),</li>
<li>Reduces the processing time of sequences comparisons while providing highest quality results,</li>
<li>Contains a fully integrated data filtering engine capable of selecting relevant hits with user-defined criteria (E-Value, identity, coverage, alignment length, etc.),</li>
<li>Does not require any additional hardware, since it is a software solution. It is easy to install, cost-effective, takes full advantage of multi-core processors and uses a small RAM footprint,</li>
<li>Ready to be used on desktop computer, cluster, cloud as well as within distributed system running Hadoop.</li>
</ul>
<p>https://plast.inria.fr/</p><p>Address of the bookmark: <a href="https://plast.inria.fr/" rel="nofollow">https://plast.inria.fr/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36812/porechop-tool-for-finding-and-removing-adapters-from-oxford-nanopore-reads</guid>
	<pubDate>Tue, 29 May 2018 07:33:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36812/porechop-tool-for-finding-and-removing-adapters-from-oxford-nanopore-reads</link>
	<title><![CDATA[Porechop:  tool for finding and removing adapters from Oxford Nanopore reads]]></title>
	<description><![CDATA[<p>Porechop is a tool for finding and removing adapters from <a href="https://nanoporetech.com/">Oxford Nanopore</a> reads. Adapters on the ends of reads are trimmed off, and when a read has an adapter in its middle, it is treated as chimeric and chopped into separate reads. Porechop performs thorough alignments to effectively find adapters, even at low sequence identity.</p>
<p>Porechop also supports demultiplexing of Nanopore reads that were barcoded with the <a href="https://store.nanoporetech.com/native-barcoding-kit-1d.html">Native Barcoding Kit</a>, <a href="https://store.nanoporetech.com/pcr-barcoding-kit-96.html">PCR Barcoding Kit</a> or <a href="https://store.nanoporetech.com/rapid-barcoding-sequencing-kit.html">Rapid Barcoding Kit</a>.</p><p>Address of the bookmark: <a href="https://github.com/rrwick/Porechop" rel="nofollow">https://github.com/rrwick/Porechop</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>