Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution

Address of the bookmark: https://github.com/envgen

Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.  

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Here are few companies:

https://mynucleus.com/

https://myome.com/

https://nebula.org/whole-genome-sequencing-dna-test/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Understanding Genome Screening

Genome screening involves analyzing an individual's DNA to identify genetic variations that may influence health and disease susceptibility. This can range from simple single-gene tests to comprehensive whole-genome sequencing. By peering into our genetic blueprint, we can uncover risks for conditions like cancer, diabetes, cardiovascular diseases, and even rare genetic disorders.

The process is straightforward: a saliva or blood sample is collected, and advanced sequencing technologies decipher the genetic code. The results provide a personalized health map, guiding lifestyle modifications, preventive measures, or medical interventions.

A Shift from Reactive to Proactive Healthcare

Traditional healthcare often focuses on treating diseases after they manifest. Genome screening flips this model on its head, enabling a shift toward prevention and early intervention. For instance:

• Cancer Risk Management: Individuals with BRCA1 or BRCA2 gene mutations can opt for enhanced screening programs or preventive surgeries to mitigate their risk of breast and ovarian cancers.

• Cardiovascular Health: Genetic predispositions to conditions like familial hypercholesterolemia can prompt early cholesterol monitoring and lifestyle adjustments.

• Rare Diseases: Identifying carriers of genetic disorders can aid in family planning and reduce the incidence of inherited conditions.

The Ethical and Practical Concerns

While genome screening offers incredible promise, it is not without challenges:

1. Accuracy and Interpretation: Genetic predisposition does not guarantee disease. Misinterpretation of results can lead to unnecessary anxiety or unwarranted medical interventions.

2. Privacy and Data Security: Genetic data is highly sensitive. Ensuring robust data protection measures is crucial to prevent misuse.

3. Accessibility and Equity: High costs and limited availability may restrict access to genome screening, exacerbating health disparities.

Balancing Science and Pseudoscience

The comparison of genome screening to horoscopes isn’t entirely unfounded. Both offer predictive insights, but the scientific foundation of genome screening distinguishes it from astrology. Unlike the alignment of celestial bodies, genetic predictions are based on rigorous data and evidence. However, the probabilistic nature of genetic predispositions underscores the importance of interpreting results in conjunction with clinical and lifestyle factors.

The Road Ahead

As genome screening becomes more affordable and integrated into routine healthcare, its potential to transform lives is immense. Policymakers, healthcare providers, and genetic counselors must collaborate to ensure ethical implementation, public awareness, and equitable access.

Imagine a future where your genetic "horoscope" is a trusted guide, not just a prediction. Early genome screening could help chart a healthier path for generations, making it a cornerstone of personalized medicine. After all, our genes might just hold the key to unlocking a future of better health and well-being.

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}