<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29284?offset=520</link>
	<atom:link href="https://bioinformaticsonline.com/related/29284?offset=520" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/14339/apps-for-busy-bioinformatics-researchers</guid>
	<pubDate>Mon, 25 Aug 2014 01:26:19 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/14339/apps-for-busy-bioinformatics-researchers</link>
	<title><![CDATA[Apps for Busy Bioinformatics Researchers !!!]]></title>
	<description><![CDATA[<h3>DNAApp:</h3><h4><strong>DNAApp: for </strong><a href="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8" target="_blank"><strong>iPhone/iPad</strong></a></h4><p>This is an <a href="http://www.apple.com/ios/" target="_blank" title="IOS">iOS</a> app that allows for the opening and analysis of <a href="http://en.wikipedia.org/wiki/DNA_sequencing" target="_blank" title="DNA sequencing">DNA sequencing</a> files - ab1. It includes handy tools such as "<a href="http://en.wikipedia.org/wiki/Complementarity_%28molecular_biology%29" target="_blank" title="Complementarity (molecular biology)">Reverse Complement</a>", "Jump to", "<a href="http://en.wikipedia.org/wiki/Cut%2C_copy%2C_and_paste" target="_blank" title="Cut, copy, and paste">Copy and Paste</a> sequences", fast and end scrolling, "<a href="http://en.wikipedia.org/wiki/Chromatography" target="_blank" title="Chromatography">Chromatogram</a> adjustments", and "Searching for segments" functions. <br /> When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files. <br /> This app works with cloud storage access like Dropbox to your sequencing files. <br /> This is now compatible with the new update for iOS 7.1. <br /> Demo video can be found at:<strong> https://www.youtube.com/watch?v=mXeo9hXdZgM&nbsp;</strong></p><p><strong>More @ </strong><a href="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8" target="_blank" title="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8"><strong>https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8</strong></a></p><h4><a href="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en" target="_blank"><strong>DNAApp: For android</strong></a></h4><p>This is the first android app that allows for the opening and analysis of DNA sequencing files - ab1. It includes handy tools such as "Reverse Complement", "Jump to", fast and end scrolling, "Chromatogram adjustments", amino acid translations, "export to fasta", and "searching for segment" function.</p><ul>
<li>When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files.</li>
<li>This app works with cloud storage access like Dropbox to your sequencing files.</li>
<li>This is now compatible with the new update for <a href="http://code.google.com/android/" target="_blank" title="Android">Android</a> 4.4.2.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en"><strong>https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en</strong></a></p><h3>BioGene:iPhone/iPad</h3><p>BioGene is an information tool for biological research. Use BioGene to learn about gene function. Enter a gene symbol or gene name, for example "CDK4" or "cyclin dependent kinase 4" and BioGene will retrieve its gene function and references into its function (<a href="http://en.wikipedia.org/wiki/GeneRIF" target="_blank" title="GeneRIF">GeneRIF</a>).</p><ul>
<li>BioGene was produced in affiliation with the Computational Biology Center at <a href="http://maps.google.com/maps?ll=40.764096,-73.956842&amp;spn=0.01,0.01&amp;q=40.764096,-73.956842%20%28Memorial%20Sloan%E2%80%93Kettering%20Cancer%20Center%29&amp;t=h" target="_blank" title="Memorial Sloan&ndash;Kettering Cancer Center">Memorial Sloan-Kettering Cancer Center</a> with primary information from Entrez Gene at the <a href="http://maps.google.com/maps?ll=38.994994,-77.099339&amp;spn=0.01,0.01&amp;q=38.994994,-77.099339%20%28National%20Center%20for%20Biotechnology%20Information%29&amp;t=h" target="_blank" title="National Center for Biotechnology Information">NCBI</a>.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/biogene/id333180084?mt=8" target="_blank" title="https://itunes.apple.com/us/app/biogene/id333180084?mt=8"><strong>https://itunes.apple.com/us/app/biogene/id333180084?mt=8</strong></a></p><h3>Mentha - the interactome browser: Android</h3><p>About: mentha - the interactome browser, is a project that offers protein-protein physical/enzymatic interaction information from various sources. For more details about mentha, visit mentha's website. This client application is an independent project. This application is designed to allow you to search proteins on the go.</p><h4><strong>Key features (Also in website):</strong></h4><ul>
<li>Search proteins by <a href="http://en.wikipedia.org/wiki/UniProt" target="_blank" title="UniProt">UniProt</a> IDs, gene name or keywords</li>
<li>Collect proteins from different queries.</li>
<li>Spot common interactors in clusters.</li>
<li>Easily distinguish between proteins from Homo sapiens and other organisms (Yellow rounded rectangles)</li>
<li>Click on edges(links) to get scientific evidence.</li>
<li>Click on proteins to see descriptions.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en"><strong>https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en</strong></a></p><h3>GeneIndex: iPhone/iPad</h3><p>GeneIndex quickly provides information about genes from various sources. It also includes a RSS reader for journal feeds as well as a PubMed viewer.</p><h4><strong>Key Features:</strong></h4><ul>
<li>Look up genes by symbol or description.</li>
<li>Gene indexes for many mammals, plants, invertebrates, and bacteria.</li>
<li>Link to gene info on websites.</li>
<li>Download files for offline use. (.pdf, .mp3, .m4v, .doc, .ppt, .xls )</li>
<li>transfer files via open in, email, or iTunes file sharing</li>
<li>View RSS feeds for journals</li>
<li>Query GeneRIF interactions, COSMIC mutations, and CNV data for cell lines.</li>
<li>Does not require a network connection for local databases.</li>
<li>View and search PubMed in table view.</li>
</ul><p><br /> GeneIndex provides a convenient and portable way to lookup gene symbols while at a seminar, conference, or lab meeting. Genes are linked to common life science websites such as NCBI, COSMIC, KEGG, PubMed, SymAtlas, UCSC genome browser, Pathway Commons, Genatlas, Wikipedia, HUGO, and OMIM. GeneRIF gene interactions can also be queried.</p><ul>
<li>Keep current on the scientific literature. GeneIndex includes a RSS reader and web browser for browsing popular journals like Nature, Science, and Cell. You can also add your own RSS feeds. PDFs and podcasts can be saved as files that you can view on the device or email as attachments.</li>
<li>Examine the status of genes in common cell lines. A subset of COSMIC containing cell lines can be queried for mutations. Copy Number Variation (CNV) plots from cell lines profiled by GSK and Sanger are also linked to genes.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/geneindex/id319769866?mt=8" target="_blank" title="https://itunes.apple.com/us/app/geneindex/id319769866?mt=8"><strong>https://itunes.apple.com/us/app/geneindex/id319769866?mt=8</strong></a></p><h3>Genome Voyager: iPad</h3><p>Gain first hand experience identifying the genomic basis of disease by analyzing cases with whole genome sequencing data that have been published for research and learning purposes.</p><ul>
<li>Visualize whole human genome sequencing data including small variations, copy number variations (CNVs), and loss of heterozygosity (LOH) events</li>
<li>Quickly find variants of interest by filtering variants based on associated genes, functional impact, allele frequency in data sets, and cross-references with various genomic databases.</li>
<li>Collaborate on variant assessments with other researchers and academics to improve knowledge of both pathogenic and benign variants. <br /> To use Genome Voyager, users must join Genome Voyager&rsquo;s community of researchers and academics. Visit <strong>http://voyager.completegenomics.com to signup.</strong></li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8" target="_blank" title="https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8"><strong>https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8</strong></a></p><h3>YeastGenome: iPhone/iPad</h3><p>Use YeastGenome to quickly find fundamental information about Saccharomyces cerevisae genes and chromosomal features. Search gene names, gene descriptions or browse the database to find information about your favorite gene, as well as more detailed information such as Gene Ontology, mutant phenotype, and protein and genetic interaction data. <br /> YeastGenome contains the latest from the Saccharomyces Genome Database (www.yeastgenome.org) in an on bound app database. As more detailed information is presented the app switches to web services access to SGD, and then for even more details provides complete information via hyperlinks to the appropriate SGD database pages.</p><h4><strong>Key features:</strong></h4><ul>
<li>Search using gene name or keywords</li>
<li>Browse by feature type</li>
<li>Save your favorite features</li>
<li>Can be used in airplane mode</li>
<li>Email information about features to collaborators</li>
</ul><h4><strong>What's New in Version 1.8.1</strong></h4><ul>
<li>This update is required to provide continued functionality. Some of the data provided by this app accesses the SGD service using a method that is changing in May 2013. This version provides changes to allow access to continue. The on board database of yeast gene information has also been updated to March 2013.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8" target="_blank" title="https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8"><strong>https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8</strong></a></p><h3>SNPdbe: iPhone/iPad</h3><p>SNPdbe &mdash; SNP database of effects, with predictions of computationally annotated functional impacts of SNPs. Database entries represent nsSNPs in dbSNP and 1000 Genomes collection, as well as variants from UniProt and PMD. SAASs come from &gt;2600 organisms; &lsquo;human&rsquo; being the most prevalent. The impact of each SAAS on protein function is predicted using the SNAP and SIFT algorithms and augmented with experimentally derived function/structure information and disease associations from PMD, OMIM and UniProt.</p><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8" target="_blank" title="https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8"><strong>https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8</strong></a></p><h3>SimGene: iPhone/iPad / Android</h3><h4><strong>SimGene: for iPhone/iPad </strong></h4><p>SimGene is an iPhone/iPad/iPod touch application designed for molecular biologists, bioinformaticians and medical researchers. The application interfaces with Simbiot, Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations and many other databases to retrieve up-to-date annotation information for over 30 species, based on gene symbol search. The application provides gene and transcript cross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene also contains an integrated genome browser with information on genes, transcripts, exons and SNPs.</p><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/simgene/id427772349?mt=8" target="_blank" title="https://itunes.apple.com/us/app/simgene/id427772349?mt=8"><strong>https://itunes.apple.com/us/app/simgene/id427772349?mt=8</strong></a></p><h4><strong>SimGene: for Android</strong></h4><p>bioinformaticians and medical researchers. The application interfaces with Simbiot,Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations andmany other databases to retrieve up-to-date annotation information for over 30species, based on gene symbol search. The application provides gene and transcriptcross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene alsocontains an integrated genome browser with information on genes, transcripts,exons and SNPs.</p><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=com.japanbioinformatics.simgene&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=com.japanbioinformatics.simgene&amp;hl=en"><strong>https://play.google.com/store/apps/details?</strong></a></p><h3>TimeTree: iPhone/iPad</h3><p>TimeTree is a public knowledge-base for information on the evolutionary timescale of life. This application allows easy exploration of the thousands of divergence times among organisms in the scientific literature. A tree-based (hierarchical) system is used to identify all published molecular time estimates bearing on the divergence of two chosen organisms, such as species, compute summary statistics, and present the results. Names of two taxa to be compared are entered in the search window and the results are presented on a set of self-explanatory tabs.</p><ul>
<li>TimeTree 3.0 was released September 27, 2011 with new data from 1209 studies including 25342 time nodes. We will be adding more data in the future as it comes in from researchers.</li>
<li>TimeTree is jointly directed by Blair Hedges (Pennsylvania State University) and Sudhir Kumar (Arizona State University). This project has been supported, in part, by grants from the National Science Foundation, National Institutes of Health, NASA Astrobiology Institute, and Science Foundation of Arizona.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/timetree/id372842500?mt=8" target="_blank" title="https://itunes.apple.com/us/app/timetree/id372842500?mt=8"><strong>https://itunes.apple.com/us/app/timetree/id372842500?mt=8</strong></a></p><h3><strong>GeneGroove: iPhone/iPad </strong></h3><p>GeneGroove is the first application to create a music melody from DTC-Genomics data. If you own 23andMe (Mountain View, CA) personal genomic results, GeneGroove will create for you a unique melody intimately based on your 23andMe genome informations. The music in you.</p><ul>
<li>After uploading your 23andMe raw data onto your iPhone via iTunes, GeneGroove will analyze your genome informations and generate a unique identifier key. This key, called the GeNumber, will embed the uniqueness of your genome data while keeping your privacy safe, and will be used by GeneGroove to generate your music melody.</li>
<li>The GeNumber doesn't contain anymore genomic information but it is based on your genome and it is unique, it is yours. It will be used in upcoming Portable Genomics applications to mix and remix music, manipulate sounds and share your art with your friends and family.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/genegroove/id492247404?mt=8" target="_blank" title="https://itunes.apple.com/us/app/genegroove/id492247404?mt=8"><strong>https://itunes.apple.com/us/app/genegroove/id492247404?mt=8</strong></a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14899/post-doc-positions-at-the-institute-of-evolution-university-of-haifa-haifa-israel</guid>
  <pubDate>Thu, 04 Sep 2014 03:59:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Post-Doc Positions at the Institute of Evolution, University of Haifa, Haifa, Israel]]></title>
  <description><![CDATA[
<p>We are looking for independent, motivated, diligent, laborious, dedicated Bioinformaticians as post-doctorate fellows for a project aimed at revealing the mechanisms of cancer-resistance and anti-cancer activity of the hypoxia-tolerant subterranean, blind mole-rat, Spalax along its underground evolutionary adaptations. Our project has captured the interest of the scientific community and we have ample financial support for the studies. Generous fellowships ($30K to $40K according to qualifications and performance) are available, immediately, for Post-Docs experts in bioinformatics with a background of good understanding biological questions. That is that can independently handle raw output data of RNA-seq / miR seq/ Genomic, analyze it and can interpret intelligently the relevant biological background. Outstanding candidates for PhD experienced in Bioinformatics will also be considered. Familiarity with cancer research is an advantage. Experience of writing manuscripts for publication and a publication record in relevant journals are expected. English skills both oral and written are required. American, Western-European or Israeli education is a significant benefit. </p>

<p>Our present objectives is to identify and isolate the substances secreted by Spalax cells, resolve with which components they interact that are active only on cancer cells, in order to unravel the biological mechanisms and pathways that evolved in Spalax cell machinery and ultimately lead to the death of cancer-cells. The study could attest to be a breakthrough in cancer research, using the long lived, hypoxia- and cancer-tolerant Spalax as a significant biological resource for biomedical research that hopefully could open new horizons in treatment and prevention of cancer in humans. </p>

<p>Contact: The applications should be submitted, together with extended CV and bibliography, summary of past accomplishments, and contact information of 3 referees, to Prof of Research Aaron Avivi (aaron@research.haifa.ac.il) AND Dr. Imad Shams (imadshams@gmail.com). (http://bit.ly/1lywShk) aaron@research.haifa.ac.il </p>

<p>More at http://evolution.haifa.ac.il/index.php/29-people/personal-websites/77-personal-site-avivi</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/15030/software-engineercomputational-biologist-equinome-ltd-dublin-ireland</guid>
  <pubDate>Thu, 04 Sep 2014 19:21:26 -0500</pubDate>
  <link></link>
  <title><![CDATA[Software engineer/Computational Biologist - Equinome Ltd., Dublin, Ireland]]></title>
  <description><![CDATA[
<p>Equinome (www.equinome.com) is the world leader in the research and<br />development of state-of-the-art novel genomic tools to inform the breeding,<br />selection and training of Thoroughbred racehorses. Since its launch in 2010,<br />Equinome has successfully commercialised three performance-related genetic<br />tests, with a pipeline of further genetic tests in development. We work with<br />many of the world's leading racehorse trainers and breeders in Europe,<br />Australasia, USA and South Africa. The company has been featured on CNN,<br />Bloomberg, RTE, BBC, The Guardian, Discovery Channel and Channel 4, among<br />others.</p>

<p>The Role</p>

<p>We are looking for a Software Engineer - Computational Biologist with 3+<br />years' experience in a similar role to design and implement a backend system<br />to support an online individualised genomics interface. This position is a<br />great opportunity for an ambitious, self-motivated individual to work in a<br />demanding, challenging and interesting role.</p>

<p>Position Description:<br />. Participate in planning, design, and implementation of Equinome back<br />end systems and technologies.<br />. Implement interfaces and management tools for back end services.<br />. Manage, analyse, interpret and visualise large genomics data sets.<br />. Work closely with scientific team to develop new features and<br />application enhancements<br />. Design, develop and manage a genomics research database.</p>

<p>Qualification/Experience:<br />. Minimum MSc in Computer Science, Genetics, Bioinformatics or in a<br />related field (A Ph.D qualification would be an advantage).<br />. Proven 3+ years of experience in similar role.<br />. Highly proficient in Python, SQL, MySQL.<br />. Excellent knowledge of mammalian genomics, bioinformatics and<br />statistical/population genetics.<br />. Hands-on experience working with large data sets.<br />. Experience with front-end technologies (HTML/CSS/Javascript) an<br />advantage.<br />. Experience in rapid web application development: e.g. Django.<br />. Knowledge or experience of Unix Scripting and R statistical<br />programming language would be an advantage.<br />. Ability to work with minimum supervision to deliver high-quality<br />code on time.<br />. Fluency in English and good written and communication skills.<br />. Meticulous attention to detail.</p>

<p>Applications should be submitted before Friday, 26 September 2014 using the<br />following link:<br />http://bit.ly/WgbhxS</p>

<p>Note: Full information and application procedure is available at this link:<br />http://bit.ly/WgbhxS</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/16313/project-assistant-position-at-jmi</guid>
  <pubDate>Fri, 12 Sep 2014 00:37:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Assistant Position at JMI]]></title>
  <description><![CDATA[
<p>Project Assistant Position (@ Rs.10,000/pm Fixed) is available for one year ina research project funded by the Department of Science and Technology entitled, "Folding and stability of naturally truncated photosynthetic pigment,C- phycoerythrin from cyanobacterium Phormidium tenue", at Centre forInterdisciplinary Research in Basic Sciences, lamia Millia Islamia, New Delhi-110025 under' the supervision of Dr. Md. Imtaiyaz Hassan (PrincipalInvestigator).</p>

<p>Eligibility:<br />M.Sc. in any stream of Life Sciences with minimum 55% marks.</p>

<p>Desirable:<br />Candidates having experience in Molecular Spectroscopy, Protein Folding and Bioinformatics will be preferred.</p>

<p>Interested candidate may appear in the walk in Interview conducted on September 16, 2014 (Tuesday) 11:00 AM in the Director's Office, Centre for Interdisciplinary Research in Basic Sciences, lamia Millia Islamia, New Delhi-110025.<br />Candidates are required to bring a set of Xerox copy of their recent CV and qualifying degree (certificate/mark sheet) along with original documents. NoTA/DA will be paid.</p>

<p>For any further information you may e-mail to: mihassan@jmLac.in</p>

<p>Read more at http://jmi.ac.in/upload/advertisement/jobs_cirbs_2014september8.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17188/jamia-hamdard-bioinformatics-faculty-jobs-2014</guid>
  <pubDate>Sat, 20 Sep 2014 21:00:05 -0500</pubDate>
  <link></link>
  <title><![CDATA[JAMIA HAMDARD Bioinformatics Faculty Jobs 2014]]></title>
  <description><![CDATA[
<p>JAMIA HAMDARD</p>

<p>(Deemed University)</p>

<p>Hamdard Nagar, New Delhi – 110 062</p>

<p>R E C R U I T M E N T</p>

<p>(Advertisement No. 5/2014)</p>

<p>Applications on prescribed form are invited for filling up the following teaching positions in the Department of Biotechnology, Faculty of Science in the university. Eligible candidates may apply on or before 30.09.2014.</p>

<p>1. Professor/Associate Professor - One in Pay Band of Rs. 37400-67000+ AGP Rs.10000/9000</p>

<p>2. Assistant Professor                   -  Two in Pay Band of Rs. 15600-39100+ AGP Rs. 6000/-</p>

<p>ASSISTANT PROFESSOR – 02 (including 01 SFS)</p>

<p>Specialization : Bioinformatics</p>

<p>Qualification and Experience :</p>

<p>Ph.D. in Biotechnology or an allied discipline with M.Sc. in Biotechnology/ Biochemistry in the First division or equivalent grade from a recognized University/ Institute.</p>

<p>NET in Life Science or allied discipline in addition to the above qualification.</p>

<p>Experience : At  least two years of Post-doctoral teaching and/or research experience in Bioinformatics or relevant field in a UGC recognized Institution of repute or international research institute/ University.  Proof of research to be evidenced by publications in SCI-indexed journals of high impact factor as the first or corresponding author.</p>

<p>Note : University may consider exempting candidates from NET, who has been awarded Ph.D. degree from ‘A’ Grade accredited University following the procedure as notified by the UGC in its Regulations of 2009 and adopted by Jamia Hamdard.</p>

<p>For more information: http://www.jamiahamdard.ac.in/PDF/Online%20application%20form%20_Teaching_1.pdf<br />http://www.jamiahamdard.ac.in/PDF/PBAS.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/17500/joao-pedro-de-magalhaes-lab</guid>
  <pubDate>Fri, 26 Sep 2014 19:08:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Joao Pedro de Magalhaes Lab]]></title>
  <description><![CDATA[
<p>Ageing has a profound impact on human society and modern medicine, yet it remains a major puzzle of biology. The goal of my work is to help understand the genetic, cellular, and molecular mechanisms of ageing. In the long term, I would like my work to help ameliorate age-related diseases and preserve health. No other biomedical field has so much potential to improve human health as research on the basic mechanisms of ageing. Please see our lab website for further details about our work and publications. </p>

<p>Functional and Comparative Genomics</p>

<p>http://jp.senescence.info/<br />http://www.senescence.info/<br />http://www.liv.ac.uk/integrative-biology/staff/joao-de-magalhaes/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>