A position for a doctoral candidate is available in Leila Taher’s new lab at the Institute for
Biomedical Informatics at Graz University of Technology (Austria, https://www.bioinfo.tugraz.at).
We develop and apply regulatory genomics and systems biology approaches to analyze large
genomic datasets. Our long-term goal is to gain novel insights into the mechanisms and
evolution of differential gene expression

Link:
https://www.tugraz.at/fileadmin/user_upload/tugrazExternal/1565e0f6-6c94-4077-a118-f84bc91c4b07/Stellenausschreibung_Bioinfo_FWF_Jan2020_EN.pdf

Introductory Articles/ppt/sources:

http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375

http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf

http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html

http://davetang.org/muse/tag/pathway/

https://www.biostars.org/p/42219/

http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf

http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf

Impotant Database and Tools:

GeneMANIA, Cytoscape, IPA and Metacore (Commerical ), Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo, WebGestalt ,ConsensusPathDB ,GSEA,Blast2go

Popular R based tools:

Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat

More:

http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

http://cancerwebpa.jefferson.edu/iSeqQC/

https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3399-8

Address of the bookmark: https://github.com/gkumar09/iSeqQC

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

version 1.0.0 - updates several descriptions and tests. To achieve v0.9.4, one can visit https://github.com/zhyqin/SEASTAR-0.9.4 for download.

Address of the bookmark: https://github.com/Xinglab/SEASTAR

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Why Normalize RNA-Seq Data?

Normalization is a crucial step in RNA-Seq analysis for the following reasons:

• Sequencing depth: Different RNA-Seq experiments produce varying numbers of reads, making direct comparisons between samples misleading.

• Gene length: Longer genes inherently generate more reads, irrespective of their actual expression level.

• Bias reduction: Normalization mitigates technical biases, enabling meaningful biological interpretation.

TPM (Transcripts Per Million)

TPM measures the proportion of reads mapped to a transcript, normalized by transcript length and sequencing depth. It is calculated as:

Key Features:

1. Proportionality: TPM values sum to 1,000,000 across all transcripts in a sample, making it easier to compare between samples.

2. Intuitive interpretation: TPM values directly represent the abundance of transcripts in a sample.

3. Preferred for comparisons: TPM facilitates between-sample comparisons better than FPKM.

FPKM (Fragments Per Kilobase Million)

FPKM normalizes read counts by transcript length and sequencing depth, but without enforcing proportionality like TPM. It is defined as:

Key Features:

1. Historical significance: FPKM was one of the first normalization methods used for RNA-Seq.

2. Single-end vs. paired-end: In paired-end sequencing, FPKM becomes RPKM (Reads Per Kilobase Million).

3. Limited utility: FPKM values are not as robust as TPM for cross-sample comparisons due to lack of proportionality.

CPM (Counts Per Million)

CPM normalizes raw read counts by sequencing depth, without considering gene length. It is expressed as:

Key Features:

1. Simplicity: CPM is straightforward and computationally less intensive.

2. Application: Suitable for non-length-dependent analyses, such as comparing total expression levels or differential expression analysis.

3. Gene length agnostic: CPM does not correct for gene length, making it less ideal for measuring expression levels.

When to Use Each Method

• TPM: Best for comparing expression levels between samples, especially when transcript length and sequencing depth vary.

• FPKM: Useful for historical consistency but generally replaced by TPM.

• CPM: Ideal for differential expression analysis when gene length normalization is unnecessary.

Conclusion

Choosing the right normalization method depends on the specific objectives of your RNA-Seq analysis. TPM’s proportionality and robustness make it the preferred choice for most applications, while CPM serves well for differential expression studies. Although FPKM paved the way for RNA-Seq normalization, it has largely been supplanted by TPM in modern workflows. Understanding these methods and their nuances ensures accurate and meaningful interpretations of RNA-Seq data.

References:

1. Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics.

2. Trapnell, C., et al. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnology.

3. Law, C. W., et al. (2014). voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biology.

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}