Before you go down that path, consider this critical biological question:
Are you sequencing human cells—or bacterial contamination?

The Silent Saboteur: Mycoplasma in Cell Cultures

Mycoplasma contamination remains one of the most widespread and underdiagnosed issues in tissue culture work. Studies suggest that 15–35% of cell lines in use may be contaminated, often without visible signs. Unlike other microbial infections, Mycoplasma does not produce cloudiness, odor, or a change in pH. Many researchers won’t detect it unless they specifically test for it.

The consequences, however, are profound. Mycoplasma can significantly alter:

• Host gene expression patterns

• Cell proliferation rates

• Epigenetic profiles and chromatin accessibility

• Cytokine signaling and immune responses

In short, it can skew your results, compromise your biological conclusions, and invalidate weeks or months of research.

A Simple Diagnostic Step: Map Against Mycoplasma Genomes

If you encounter poor alignment rates to the human genome, consider mapping your reads to a Mycoplasma reference genome—or better yet, use a combined human + Mycoplasma reference. There have been cases where over half of all reads, initially assumed to be from human cells, were in fact bacterial in origin. This check is fast, easy, and could save your project.

How Contamination Happens—and Persists

Mycoplasma is small (0.1–0.3 μm), lacks a cell wall, and can pass through standard filters undetected. Common sources include:

• Contaminated reagents (e.g., FBS)

• Infected cell lines obtained from other labs

• Poor aseptic technique or shared equipment

Once present, it spreads quickly between cultures and can persist for months, silently affecting results.

Why Treatment Is Difficult

While antibiotics such as Plasmocin or BM-Cyclin are sometimes used, they often offer only partial resolution and may themselves alter cell behavior. In many cases, the best course of action is to discard the contaminated culture and start with a fresh, verified stock.

Practical Recommendations for Researchers

• Routinely test for Mycoplasma using PCR, qPCR, or fluorescence-based assays

• Incorporate contamination screens into your sequencing QC pipeline

• Use combined reference genomes when mapping ambiguous reads

• Practice strict aseptic technique and monitor all incoming cell lines

• Don’t ignore unexplained data anomalies—they might point to contamination

Closing Thought: Contamination Is a Biological Variable

It’s easy to view poor mapping as a technical issue, but sometimes the problem lies deeper—in the biology itself. Mycoplasma contamination doesn’t just interfere with sequencing; it interferes with science. As a research community, we must treat contamination not as an afterthought, but as a key variable to control.

So next time your reads won’t align, don’t just tune the aligner. Ask if your cells are telling the truth—or if they're hiding something.

Employer: Jawaharlal Nehru University
Address: Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067
Email: not mentioned / provided for this job post
URL: http://www.jnu.ac.in/Career/currentjobs.htm
Phone: 011 2674 2575
Skills: not mentioned / required for this job post
Experience: Experience in molecular biology, structural biology and bioinformatics is desired
Education: M.Sc. in any field of life sciences.
Job Location: New Delhi, Delhi, India (View Jobs in New Delhi, Jobs in Delhi, Jobs in India)

Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec

Name of the Post: JRF / SRF / RA

Salary: As per rules

Required Job Profile:

Candidate must possess M.Sc. in any field of life sciences.

Desired Job Profile:

Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.

How to apply:

Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.

Refer to http://www.jnu.ac.in/Career/currentjobs.htm

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83