<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29384?offset=1300</link>
	<atom:link href="https://bioinformaticsonline.com/related/29384?offset=1300" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7753/jrf-pondicherry-university</guid>
  <pubDate>Fri, 03 Jan 2014 16:48:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ PONDICHERRY UNIVERSITY]]></title>
  <description><![CDATA[
<p>PONDICHERRY UNIVERSITY</p>

<p>CENTRE FOR BIOINFORMATICS</p>

<p>PUDUCHERRY</p>

<p>Applications are invited for one Project Assistant to work in the UGC sponsored Research Award "Molecular Docking and Dynamics studies to understand the interacting mechanism of oncogenic 101 protein with its cellular proteins".</p>

<p>The duration for the fellowship is 12months only with consolidated pay ofRs. 5,000 per month.</p>

<p>Application on plain paper with following details: Name, Address, Data of Birth, Father's Name, Nationality, Educational Qualification (SSLC onwards-enclose attested copies of certificate) and Researcb Experience may be addressed to Dr. R. Krishna, Principle Investigator (PI), UGC Research Award, Centre for Bioinformatics, Pondicherry University, Pondicherry - 605 014.</p>

<p>Application should reach in January 261h , 2013.</p>

<p>Essential Qualification: M.Sc. in Bioinformatics/Biophysics with good academic record.</p>

<p>Qualification for Project Fellow:</p>

<p>M.Sc in Bioinformatics/Biophysics.</p>

<p>The person to be considered for appointment as Project Fellow must have second class master degree with a minimum of 55% marks in the subject concerned or a related subject.</p>

<p>The candidate to be appointed as Project Fellows should be below thc age of40 years at the time of appointment.</p>

<p>Desirable Qualification for this Project: Research Experience in Small/Macromolecule Crystallography and Structural Bioinformatics.</p>

<p>For more details, refer the web site: www.pondiuni.edu.in/sites/default/files/BIC-311213.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7998/faculty-positions-at-iiit-allahabad</guid>
  <pubDate>Thu, 23 Jan 2014 06:19:34 -0600</pubDate>
  <link></link>
  <title><![CDATA[FACULTY POSITIONS AT IIIT-ALLAHABAD]]></title>
  <description><![CDATA[
<p>OPENINGS OF FACULTY POSITIONS AT IIIT-ALLAHABAD</p>

<p>(Under Tenure-Track Model)</p>

<p>Open Advt. No IIITA/DIC/16012014</p>

<p>IIIT-Allahabad has several Openings for the Faculty positions at the Assistant Professor level.</p>

<p>It is a regular tenure-track faculty positions for 3-5 years in teaching and research. A regular faculty is expected to engage heavily in research and teaching. The eligibility criteria for regular faculty positions are similar as in IITs. For an Assistant Professor position, a candidate must have a PhD (in IT/Computer Science &amp;/or Engineering/Electrical, Electronics &amp;/or Communication Engineering/etc; for interdisciplinary areas the PhD may be in an appropriate field), plus three years experience. However, for PhDs from a well known University/Institute (e.g. IITs/IISc/TIFR/ISI in India or well known research universities across the world), and a good research/academic record, the 3 years experience requirement may be waived.</p>

<p>The pay scale for faculty is same as in IITs. Other benefits include initiation research grant, travel support, book grant, professional society membership, etc., and personal benefits such as medical/LTC, on campus subsidized family housing with excellent modern infrastructural facilities.</p>

<p>Areas of Interest</p>

<p>IIIT-Allahabad aims to build strong research groups in important and emerging areas in CS/IT/ECE as well as in emerging interdisciplinary areas, and applications are invited in all these areas. Some of the areas of special interest, besides strengthening the existing research areas, are : Software Engineering, Theoretical Computer Science, Cyber Physical Systems, Robotics, Network science, Digital Media, Computational neuroscience, Machine learning, Healthcare informatics, Computational Biology, Communications networks (both at hardware and protocol levels), Circuits (including VLSI, analog, low power, etc), Energy systems and technologies, Biomedical electronics and systems, Computer Architecture, signal/image processing, Embedded and control systems.</p>

<p>Application Process</p>

<p>Interested candidates can apply by sending their detailed CV with list of publications clearly mentioning Journal names and citation index with three references through email entitled “Faculty positions at IIIT Allahabad” to faculty.applications@iiita.ac.in. Do not send your applications in any other email addresses. Applications will be considered regularly, hence there is no deadline for applying.</p>

<p>Important Clarifications on Eligibility</p>

<p>A PhD in CS/IT (or other disciplines, as announced) is the minimum expected requirement for an Assistant Professor.</p>

<p>Advertisement: http://iiita.ac.in/pub/Faculty-Position-IIITA1.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8198/scientist-positions-at-rajiv-gandhi-centre-for-biotechnology</guid>
  <pubDate>Thu, 06 Feb 2014 23:18:49 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Positions at Rajiv Gandhi Centre for Biotechnology]]></title>
  <description><![CDATA[
<p>Rajiv Gandhi Centre for Biotechnology</p>

<p>An Autonomous National Institute under Government of India,<br />Ministry of Science &amp; Technology<br />Department of Biotechnology</p>

<p>No: RGCB/ Advt./2014/1   <br />January 24, 2014</p>

<p>Scientist Positions</p>

<p>Group Leader in Computational Biology/Bioinformatics<br />A highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to analyze complex data sets generated by RGCB scientists and collaborators.</p>

<p>Location: Thiruvananthapuram (Trivandrum)</p>

<p>The above positions will be at the E-II, F or equivalent levels. For senior applicants with an outstanding track record, an option of a contract career path for research excellence at Scientist G or H equivalent level can also be discussed. All positions will initially be for 5 years. Essential and desired qualifications as well as other relevant details for all the above positions are posted on the RGCB website (http://www.rgcb.res.in). The last date for receiving applications is March 14, 2014.   </p>

<p>Sd/-<br />Director</p>

<p>Rajiv Gandhi Centre for Biotechnology<br />Thycaud, P.O., Poojappura,<br />Thiruvananthapuram, Kerala, India-695 014<br />Ph.: 91-471-2529400 (30 Lines), 2347975, 2348104, 2348753, 2345899<br />Fax: 91-471-2348096, 2346333</p>

<p>More at http://rgcb.res.in/jobs.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</guid>
	<pubDate>Tue, 18 Feb 2014 11:55:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</link>
	<title><![CDATA[C-DAC launch supercomputing facility "Param Bio Blaze" !!!]]></title>
	<description><![CDATA[<p>The bioinformatics centre at Centre for Development of Advanced Computing (C-DAC) completed 10 years, this month. Established in 2004, the centre has been widely used by numerous researchers across the globe and has an ultimate aim of making personalised drugs depending on the composition of a human body.<br /><br />When biological data is processed using computer science, statistics, mathematics and engineering, it constitutes bioinformatics. The technological advancements are bringing new dimensions to the understanding of molecular basis of living organisms. There is immense data generated due to computing, but storage and analysis of this data is becoming a challenge, therefore there is an urgent need of supercomputers.</p><p>The&nbsp;C-DAC will launch Param Bio Blaze, a supercomputing facility, to address the challenges in bioinformatics on Tuesday at a three-day symposium, titled: 'Accelerating biology: Computing life'. The supercomputing facility will be inaugurated on Tuesday by Ramakrishna Ramaswamy, vice-chancellor, Central University of Hyderabad at the Yashada. The new C-DAC's facility will have a capacity of 10 teraflop and will be able to analyse human cells and its functions.</p><p><img src="http://www.datacenterjournal.com/wp-content/uploads/2012/06/supercomputer.jpg" alt="image" width="1024" height="632" style="border: 0px; border: 0px;"></p><p><br />Param Bio Blaze will help have a larger storage space and better computing facility for the bioinformatics sector. The facility will help capture the movement of molecules and also interaction between two molecules and the effects.<br /><br />Applications of Param BioBlaze<br /><br />- Collaboration with National Centre for Cell Science for research on Malaria and understanding how the disease spreads<br /><br />- Collaborative work with Tata Memorial hospital on breast cancer and find out the difference between normal tissues and tissues from breast cancer patients<br /><br />- Designing anti-cancer molecules, a collaborative research with the University of Pune</p><p>Reference:</p><p>Times of India</p><p>Image:datacenterjournal.com</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</guid>
	<pubDate>Wed, 14 Nov 2018 04:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</link>
	<title><![CDATA[ANItools web: a web tool for fast genome comparison within multiple bacterial strains]]></title>
	<description><![CDATA[<p><span>ANItools is a software package written by PERL scripts that can be run in a Linux/Unix system. If you want to compare bacterial genomes and calculate their average nucleotide identity (ANI), you could download and run this program directly. Or you could send us the genome sequence by email. Then we will do the analysis work for you.</span></p>
<p><span>https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454</span></p><p>Address of the bookmark: <a href="http://ani.mypathogen.cn/" rel="nofollow">http://ani.mypathogen.cn/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</guid>
	<pubDate>Fri, 14 Feb 2014 13:16:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</link>
	<title><![CDATA[Atlas of ancient inter-ethnic group !!!]]></title>
	<description><![CDATA[<p>Now a dayz, almost 3% of the world's population lived outside their country of origin. These migration is increasingly being perceived as a force that can contribute to development, and an integral aspect of the global development process.&nbsp; While migrants make important contributions to the economic prosperity of their host countries, the flow of financial, technological, social and human capital back to their countries of origin also is having a significant impact on poverty reduction and economic development.</p><p>However, the ancient invasions and migrations to slavery and trade, history is embroidered with events that led to interactions between previously separate populations. Early humans migrated due to many factors such as changing climate and landscape and inadequate food supply. Historical migration of human populations begins with the movement of Homo erectus out of Africa across Eurasia about a million years ago. Homo sapiens appear to have occupied all of Africa about 150,000 years ago, moved out of Africa 70,000 years ago, and had spread across Australia, Asia and Europe by 40,000 years BC. Indo-Aryan migration from the Indus Valley to the plain of the River Ganges in Northern India is presumed to have taken place in the Middle to Late Bronze Age, contemporary to the Late Harappan phase in India (ca. 1700 to 1300 BC). From 180 BC, a series of invasions from Central Asia followed, including those led by the Indo-Greeks, Indo-Scythians, Indo-Parthians and Kushans in the northwestern Indian subcontinent.</p><p><img src="http://upload.wikimedia.org/wikipedia/commons/3/37/Map-of-human-migrations.jpg" alt="image" style="border: 0px; border: 0px;"></p><p>Using the recent advance technologies researchers have created a historical atlas of instances of such mixing. They use a sophisticated statistical method for making inferences about human history and&nbsp;infer populations interbredings ( happen over the past 4,000 years) with an ease.<br /><br />The study published the findings and presented with an interactive map. http://admixturemap.paintmychromosomes.com/</p><p>These sort of genomic study have some limilation. It is hard to precisely define sources of mixing when it occurred between genetically similar groups, and scenarios involving multiple waves of mixing over time or between multiple groups can be difficult to tease apart. But it is believed that larger sample sizes will improve resolution. These high resolution will provide a deeper understanding of human history.</p><p>Reference:</p><p>http://www.sciencemag.org/content/early/2014/01/28/science.1245938</p><p>http://www.ncbi.nlm.nih.gov/pubmed/21390129?dopt=Abstract&amp;holding=npg</p><p>http://www.csulb.edu/~kmacd/paper-ethnicity.html</p><p>Image: Wikipedia</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9055/computational-biologist-scientist-strand-life-sciences</guid>
  <pubDate>Fri, 14 Mar 2014 11:36:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Computational Biologist Scientist @ Strand Life Sciences]]></title>
  <description><![CDATA[
<p>We are looking for a motivated application scientist to help evaluate, compare, and develop next generation sequencing (NGS) data analysis methods. The successful candidate should be able to quickly understand the state-of-art computational biology techniques, prototype them and perform benchmarking studies. The candidate must also be comfortable working with people from different disciplines and be able to present data analysis results in a clear and effective manner. The candidate is also expected to interact with customers as needed, write technical reports and publish new methods and/or data analysis findings in public forums.</p>

<p>Candidate Requirements: A PhD in computer science, computational biology, Bioinformatics, or a related field, along with sufficient programming skills for prototyping. Experience with next generation sequencing data analysis is required. Candidates with MS degree but with relevant work experience can also be considered. The successful candidate must be motivated and capable of working independently as well as in team environment.</p>

<p>Eligible and interested candidates can email your resumes to rohit at strandls dot com</p>

<p>About Strand Life Sciences: Strand was founded in 2000 by computer science and mathematics professors who recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand’s solutions for life sciences research are robust and easy to use by the most novice user while powerful and configurable for the bioinformatician. Using its award-winning application development platform, AVADIS®, Strand builds innovative products that enable fast and cutting-edge analysis for basic and clinical research, drug discovery and development.</p>

<p>http://www.avadis-ngs.com/careers</p>
]]></description>
</item>

</channel>
</rss>