BOL: Related items

Hifiasm: a haplotype-resolved assembler for accurate Hifi reads

Jit — Thu, 24 Dec 2020 10:03:36 -0600

Hifiasm is a fast haplotype-resolved de novo assembler for PacBio Hifi reads. It can assemble a human genome in several hours and works with the California redwood genome, one of the most complex genomes sequenced so far. Hifiasm can produce primary/alternate assemblies of quality competitive with the best assemblers. It also introduces a new graph binning algorithm and achieves the best haplotype-resolved assembly given trio data.

Address of the bookmark: https://github.com/chhylp123/hifiasm

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Bioinformatics tools for telomere to telomere assembly !

BioStar — Tue, 17 Aug 2021 13:17:09 -0500

● Merfin – k-mer-based assembly and variant calling evaluation for improved consensus accuracy (Arang Rhie)
● PanGenie – algorithm that leverages a pangenome reference built from haplotype-resolved genome assemblies in conjunction with k-mer count information from raw, short-read sequencing data to genotype a wide spectrum of genetic variation (Tobias Marschall)
● SQANTI3 – an automated pipeline for the classification of long-read transcripts that can assess the quality of data and the preprocessing pipeline (Rocío Amorín de Hegedüs @rocioadh)
● tama (Transcriptome Annotation by Modular Algorithms) – software designed for processing Iso-Seq data and other long-read transcriptome data (Richard Kuo @GenomeRIK)
● pbaa (PacBio Amplicon Analysis) – separates complex mixtures of amplicon targets from genomic samples to cluster and generate high-quality consensus sequences from HiFi reads (Zev Kronenberg @zevkronenberg)
● bellerophon – analyzes MHC typing and other low-complexity gene amplicon data; performs allele calling while detecting polymorphic sites within the sequences and removing potential chimeric sequence variants (Yuanyuan Cheng @Yuanyuan929)
● svpack – tools for filtering, comparing, and annotating structural variant (SV) calls in VCF format (Aaron Wenger)
● JumboDB – tool for de Bruijn graph construction (Anton Bankevich @AntonBankevich)
● uLTRA – tool for splice alignment of long transcriptomic reads to a genome, guided by a database of exon annotations. (Kristoffer Sahlin @krsahlin)
● LeafGo – workflow to rapidly produce high-quality de novo plant genomes (Luca Ermini @ermini_luca)

Reference:

https://www.pacb.com/blog/young-investigators-share-stellar-science-career-advice-and-bioinformatics-tools-at-smrt-leiden-2021/

QuorUM: An Error Corrector for Illumina Reads

Jit — Wed, 08 Nov 2017 11:40:41 -0600

Illumina Sequencing data can provide high coverage of a genome by relatively short (most often 100 bp to 150 bp) reads at a low cost. Even with low (advertised 1%) error rate, 100 × coverage Illumina data on average has an error in some read at every base in the genome. These errors make handling the data more complicated because they result in a large number of low-count erroneous k-mers in the reads. However, there is enough information in the reads to correct most of the sequencing errors, thus making subsequent use of the data (e.g. for mapping or assembly) easier. Here we use the term “error correction” to denote the reduction in errors due to both changes in individual bases and trimming of unusable sequence. We developed an error correction software called QuorUM. QuorUM is mainly aimed at error correcting Illumina reads for subsequent assembly. It is designed around the novel idea of minimizing the number of distinct erroneous k-mers in the output reads and preserving the most true k-mers, and we introduce a composite statistic π that measures how successful we are at achieving this dual goal. We evaluate the performance of QuorUM by correcting actual Illumina reads from genomes for which a reference assembly is available.

QuorUM is distributed as an independent software package and as a module of the MaSuRCA assembly software. Both are available under the GPL open source license at http://www.genome.umd.edu.

Address of the bookmark: http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0130821

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

QuorUM: An Error Corrector for Illumina Reads

BioStar — Tue, 04 Feb 2020 23:26:55 -0600

We produce trimmed and error-corrected reads that result in assemblies with longer contigs and fewer errors. We compared QuorUM against several published error correctors and found that it is the best performer in most metrics we use. QuorUM is efficiently implemented making use of current multi-core computing architectures and it is suitable for large data sets (1 billion bases checked and corrected per day per core)

Address of the bookmark: http://www.genome.umd.edu/

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

RA at University of Delhi

Wed, 17 Jun 2015 20:35:35 -0500

Research Scientist Jobs opportunity in University of Delhi on temporary basis

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83