<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29479?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/29479?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</guid>
	<pubDate>Mon, 29 Feb 2016 17:39:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</link>
	<title><![CDATA[scikit-learn]]></title>
	<description><![CDATA[<p>Machine Learning in Python</p>
<p>Simple and efficient tools for data mining and data analysis<br> Accessible to everybody, and reusable in various contexts<br> Built on NumPy, SciPy, and matplotlib<br> Open source, commercially usable - BSD license</p>
<p>More at&nbsp;http://scikit-learn.org/stable/index.html</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://scikit-learn.org/stable/auto_examples/index.html" rel="nofollow">http://scikit-learn.org/stable/auto_examples/index.html</a></p>]]></description>
	<dc:creator>Jitendra Prajapati</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</guid>
	<pubDate>Sat, 25 Aug 2018 11:32:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</link>
	<title><![CDATA[Parallel Processing with Perl !]]></title>
	<description><![CDATA[<p>Here is a small tutorial on how to make best use of multiple processors for bioinformatics analysis. One best way is using perl threads and forks. Knowing how these threads and forks work is very important before implementing them. Getting to know how these work would be really useful before reading this tutorial.</p><p>Many times in bioinformatics we need to deal with huge datasets which&nbsp; are more than 100GB size. The traditional way to analysis a file is using the while loop</p><p>while (FILE){</p><p>Do something;</p><p>}</p><p>This is very slow(since we are using only one processor) and if we have 500 million lines in the dataset it takes more than a day to iterate through the whole dataset. So how do we make best use of all our processors and get the work done quickly?</p><p>Here is a very simple and efficient technique with perl which i have been using. I am&nbsp; more inclined towards using perl fork than perl threads.</p><p>One of the oldest way to fork is</p><blockquote><p>my $fork = fork();<br />if($fork){&nbsp;&nbsp;&nbsp;<br />push (@childs,$fork);&nbsp;<br />}<br />elseif($fork==0){<br /><strong>your code here;</strong><br />exit(0);<br />}<br />else{die &ldquo;Couldnt fork : $!&rdquo;;}</p><p>## wait for the child process to finish<br />foreach(@childs){<br />my $tmp=waitid($_,0);<br />}</p></blockquote><p>what a fork does is it creates a child process and takes the variables and code with it to analyze it separately (detached from the parent process) and thus a separate process is created( which usually runs on a separate processor). Thats it!! One big disadvantage of forking is its very difficult to share variables among the different processes. I will show you how to do it easily but still it has its own drawbacks.</p><blockquote><p>Okie, now if you really do not want to use fork in your code, that&rsquo;s okie too..There are many useful modules which do it for you very efficiently. One really useful module is Parallel::ForkManager. You can use Parallel::ForkManager to manage the number of forks you want to generate (number of processors you want to use).</p><p><strong>Simple usage:</strong><br />use Parallel::ForkManager;<br />my $max_processors=8;<br />my $fork= new Parallel::ForkManager($max_processors);<br />foreach (@dna) {<br />$fork-&gt;start and next; # do the fork<br /><strong>you code here;</strong><br />$fork-&gt;finish; # do the exit in the child process<br />}<br />$pm-&gt;wait_all_children;</p></blockquote><p>so you will be generating 8 forks which do the same thing for your each element of array. when one child finishes, Parallel::ForkManager generates a new one and thus you will be using all your processors to analyze the data. Now, if you have generated 8 child processes and want to write the data to one file. You need to lock the file to do this, because you will have problems with the buffering. You can lock the file using flock command.</p><blockquote><p>open (my $QUAL, &ldquo;myfile.txt&rdquo;);<br />flock $QUAL, LOCK_EX or die &ldquo;cant lock file $!&rdquo;;<br />print $QUAL &ldquo;$output&rdquo;;<br />flock $QUAL, LOCK_UN or die &ldquo;$!&rdquo;;<br />close $QUAL;</p></blockquote><p>I would not suggest using flock when dealing with multiple processes because it will decrease the processing efficiency( each child process must wait for the lock to be released by the other child process). Instead, I would suggest each fork writing to a separate file and after the processing just concatenating them.</p><p><strong>Putting it all together, If you have 100GB data you can do this</strong></p><blockquote><p><strong>step 1</strong>&nbsp;: split the dataset equally according to number of processors you have. this may take a few hours(about 2-3 hrs for 100GB file)<br />You can use unix &ldquo;split&rdquo; command for this<br />for example:<br />my $number_split=int($number_of_entries_in_your_dataset/$max_processors);<br />my $split_Files=`split -l $number_split &ldquo;your_file.fasta&rdquo; &ldquo;file_name&rdquo;`;</p><p><strong>step2</strong>: open you directory comtaining you split files and start Parallel::ForkManager.<br /><strong>For example:</strong><br />opendir(DIRECTORY, $split_files_directory) or die $!; ### open the directory<br />my $fork= new Parallel::ForkManager($max_processors);<br />while (my $file = readdir(DIRECTORY)) { ### read the directory<br />if($file=~/^\./){next;}<br />print $file,&rdquo;\n&rdquo;;<br />########## Start fork ##########<br />my $pid= $super_fork-&gt;start and next;<br /><strong>Whatever you want to do with the split file ;</strong><br /><strong>analyze my piece of $file;</strong><br />######### end fork ###############<br />$super_fork-&gt;finish;<br />}<br />$super_fork-&gt;wait_all_children;</p></blockquote><p>So basically each processor will be active with its piece of data (split file) and thus you have created 8 processes at one time which run without interfering with the other process. I again will not suggest writing output from each child process to one file(for reasons above). Write output from each fork to a separate file and finally concatenate them. Thats it, you have just increased your program speed by 8 times!! Isnt it easy?</p><p><strong>Note:</strong><br />You may worry about concatenation of the output each child generates, since it does take some time(remember 100GB). I think now you can use a mysql database LOAD DATA LOCAL INFILE command to load all the files into a single table(Should take about 3hrs for 100Gb dataset) and then export the whole table into one file. This should be faster than just concatenating them using &ldquo;cat&rdquo; command.(correct me if I am wrong)</p><p>Or much simpler way is to use pipes</p><p>cat output_dir/* | my_pipe or my_pipe &lt;(file1) final_file;</p><p>Thats it guys!! Enjoy programming and please do comment. I am not a computer scientist so forgive me for any mistakes and if any please report them. Thank you.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</guid>
	<pubDate>Tue, 03 Sep 2013 14:59:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</link>
	<title><![CDATA[Bioinformatics 101 -  Running BLAST]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/CYnjROfGXv8" frameborder="0" allowfullscreen></iframe>How to format the database for BLAST, run the command, view the output file, and use BioPerl and Perl to parse the output. By David Francis, Ohio State University. Delivered live at the Tomato Disease Workshop 2010. For more information, please visit http://www.extension.org/pages/32521/bioinformatics-101-video.]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</guid>
	<pubDate>Mon, 02 Jun 2014 18:03:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</link>
	<title><![CDATA[Next generation sequencing in R or bioconductor environment]]></title>
	<description><![CDATA[<p>There are many R software and bioconductor packages for NGS data analysis, some of them are as follows</p><h3><a name="TOC-Biostrings" id="TOC-Biostrings"></a>Biostrings</h3><p>The Biostrings package from Bioconductor provides an advanced environment for efficient sequence management and analysis in R. It contains many speed and memory effective string containers, string matching algorithms, and other utilities, for fast manipulation of large sets of biological sequences. The objects and functions provided by Biostrings form the basis for many other sequence analysis packages. <a href="http://bioconductor.org/packages/release/bioc/html/Biostrings.html">Documentation</a></p><div><div style="text-align: left;"><div style="color: #000000;"><h4><a name="TOC-IRanges-Overview" id="TOC-IRanges-Overview"></a>IRanges Overview</h4><p>IRanges provides the low-level infrastructure and containers for handling sets of integer ranges within Bioconductor's BioC-Seq domain. Its classes and methods provide support for many more high-level packages like GenomicRanges, ShortRead, Rsamtools, etc. <a href="http://bioconductor.org/packages/release/bioc/html/IRanges.html">Documentation</a></p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-GenomicRanges-Overview" id="TOC-GenomicRanges-Overview"></a>GenomicRanges Overview</h4><p>The <em>GenomicRanges</em> package serves as the foundation for representing genomic locations within the Bioconductor project. It is built upon the <em>IRanges</em> infrastructure and defines three major data containers - <em>GRanges, GRangesList</em> and <em>GappedAlignments</em> - which are supporting other important BioC-Seq packages including <em>ShortRead, Rsamtools, rtracklayer, GenomicFeatures</em> and <em>BSgenome</em>.&nbsp; Compared to the IRanges container, the GRanges/<em>GRangesList</em> classes are more flexible and extensible to store additional information about sequence ranges, such as chromosome identifiers (sequence space), strand information and annotation data. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p></div></div></div></div><h3><a name="TOC-Motif-Discovery" id="TOC-Motif-Discovery"></a>Motif Discovery</h3><h4><a name="TOC-cosmo" id="TOC-cosmo"></a>cosmo</h4><p>The cosmo package allows to search a set of unaligned DNA sequences for a shared motif that may function as transcription factor binding site. The algorithm extends the popular motif discovery tool MEME (Bailey and Elkan, 1995) in that it allows the search to be supervised by specifying a set of constraints that the motif to be discovered must satisfy. <a href="http://bioconductor.org/packages/release/bioc/html/cosmo.html">Documentation</a></p></div><div>
<p><span></span><span></span></p>
<div style="color: #0000ff;"><h4><a name="TOC-BCRANK" id="TOC-BCRANK"></a>BCRANK</h4><p>BCRANK is a method that takes a ranked list of genomic regions as input and outputs short DNA sequences that are overrepresented in some part of the list. The algorithm was developed for detecting transcription factor (TF) binding sites in a large number of enriched regions from high-throughput ChIP-chip or ChIP-seq experiments, but it can be applied to any ranked list of DNA sequences. Documentation</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/BCRANK.html"></a></p>
<p>rGADEM: <a href="http://bioconductor.org/packages/devel/bioc/html/rGADEM.html">Documentation</a></p><p>MotIV: <a href="http://bioconductor.org/packages/devel/bioc/html/MotIV.html">Documentation</a></p></div><h3><a name="TOC-ShortRead" id="TOC-ShortRead"></a>ShortRead</h3><p>The ShortRead package provides input, quality control, filtering, parsing, and manipulation functionality for short read sequences produced by high throughput sequencing technologies. While support is provided for many sequencing technologies, this package is primairly focused on Solexa/Illumina reads. <a href="http://bioconductor.org/packages/release/bioc/html/ShortRead.html">Documentation</a></p><h3><a name="TOC-Rsamtools" id="TOC-Rsamtools"></a>Rsamtools</h3><p>Rsamtools provides functions for parsing and inspecting samtools BAM formatted binary alignment data. SAM/BAM is quickly becoming a universal standard alignment format, and is now supported by a wide variety of alignment tools. <a href="http://bioconductor.org/help/bioc-views/2.7/bioc/html/Rsamtools.html">Documentation</a></p>
<p><a href="http://samtools.sourceforge.net/">Samtools Website</a><br /> <a href="http://bio-bwa.sourceforge.net/">BWA (Burrows-Wheeler Alignment) Website</a><br /><span style="color: #0000ff;"></span></p>
<div style="color: #000000;">&nbsp;</div></div><div>
<p><span style="color: #000000;">Additional tools for SNP analysis:&nbsp;</span></p>
<p><a href="http://bioconductor.org/help/bioc-views/release/bioc/html/snpMatrix.html">snpMatrix</a></p><h3><a name="TOC-BSgenome" id="TOC-BSgenome"></a>BSgenome</h3><p>BSgenome provides an object oriented infrastructure for interacting with a Biostring based genome sequence. BSgenome packages exist for many common genomes, and can be created to represent custom genomes. See the "How to forge a BSgenome data package" Vignette for instructions to create a new BSgenome package if a prebuilt package does not exist for your organism. <a href="http://bioconductor.org/packages/release/bioc/html/BSgenome.html">Documentation</a></p><h3><a name="TOC-rtracklayer" id="TOC-rtracklayer"></a>rtracklayer</h3><p>rtracklayer provides an interface for exporting annotation feature data to various genome browsers and file formats (such as GFF). See the Small RNA Profiling exercise for an example of using rtracklayer to visualize alignment coverage. <a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">Documentation</a></p><h3><a name="TOC-biomaRt" id="TOC-biomaRt"></a>biomaRt</h3><p>The biomaRt package, provides an interface to a growing collection of databases implementing the BioMart software suite (http:// www.biomart.org). The package enables online retrieval of large amounts of data in a uniform way without the need to know the underlying database schemas. This data is retrieved automatically via the Internet, so it's recommended that you cache the data locally, or check versions if your code will be adversely affected by updates to these data. <a href="http://bioconductor.org/packages/release/bioc/html/biomaRt.html">Documentation</a></p><h3><a name="TOC-ChIP-Seq-Analysis-Packages" id="TOC-ChIP-Seq-Analysis-Packages"></a>ChIP-Seq Analysis Packages</h3><p>Bioconductor provides various packages for analyzing and visualizing ChIP-Seq data. Only a small selection of these packages is introduced here. Additional useful introductions to this topic are: <a href="http://www.bioconductor.org/workshops/2009/SeattleJan09/ChIP-seq/">BioC ChIP-seq Case Study</a> and BioC <a href="http://www.bioconductor.org/help/course-materials/2009/SeattleNov09/ChIP-seq/">ChIP-Seq</a>.</p><h4><a name="TOC-chipseq" id="TOC-chipseq"></a>chipseq</h4><p>The chipseq package combines a variety of HT-Seq packages to a pipeline for ChIP-Seq data analysis. <a href="http://bioconductor.org/packages/release/bioc/html/chipseq.html">Documentation</a></p><h4><a name="TOC-BayesPeak" id="TOC-BayesPeak"></a>BayesPeak</h4><p>BayesPeak is a peak calling package for identifying DNA binding sites of proteins in ChIP-Seq experiments. Its algorithm uses hidden Markov models (HMM) and Bayesian statistical methods. The following sample code introduces the identification of peaks with the BayesPeak package as well as the incorporation of read coverage information obtained by the chipseq package. <a href="http://bioconductor.org/packages/release/bioc/html/BayesPeak.html">Documentation</a> [ <a href="http://www.biomedcentral.com/1471-2105/10/299">Publication</a> ]</p><h4><a name="TOC-PICS" id="TOC-PICS"></a>PICS</h4><p>The PICS package applies probabilistic inference to aligned-read ChIP-Seq data in order to identify regions bound by transcription factors. PICS identifies enriched regions by modeling local concentrations of directional reads, and uses DNA fragment length prior information to discriminate closely adjacent binding events via a Bayesian hierarchical t-mixture model. The following sample code uses the test data set from the above BayesPeak package in order to compare the results from both methods by identifying their consensus peak set. <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">Documentation</a> [ <a href="http://www.hubmed.org/display.cgi?uids=20528864">Publication</a> ]</p><h4><a name="TOC-ChIPpeakAnno" id="TOC-ChIPpeakAnno"></a>ChIPpeakAnno</h4><p>The ChIPpeakAnno package provides. batch annotation of the peaks identified from either ChIP-seq or ChIP-chip experiments. It includes functions to retrieve the sequences around peaks, obtain enriched Gene Ontology (GO) terms, find the nearest gene, exon, miRNA or custom features such as most conserved elements and other transcription factor binding sites supplied by users. The package leverages the biomaRt, IRanges, Biostrings, BSgenome, GO.db, multtest and stat packages. <a href="http://bioconductor.org/packages/release/bioc/html/ChIPpeakAnno.html">Documentation</a></p><h4><a name="TOC-Additional-ChIP-Seq-Packages" id="TOC-Additional-ChIP-Seq-Packages"></a>Additional ChIP-Seq Packages</h4><p>DiffBind: <a href="http://www.bioconductor.org/packages/release/bioc/html/DiffBind.html">Documentation</a></p><p>MOSAICS: <a href="http://bioconductor.org/packages/devel/bioc/html/mosaics.html">Documentation</a></p><p>iSeq: <a href="http://bioconductor.org/packages/release/bioc/html/iSeq.html">Documentation</a></p><p>ChIPseqR: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPseqR.html">Documentation</a></p><p>ChiPsim: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPsim.html">Documentation</a></p><p>CSAR: <a href="http://www.bioconductor.org/packages/devel/bioc/html/CSAR.html">Documentation</a></p><p>ChIP-Seq Pipeline: <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">PICS</a>, rGADEM and MotIV (<a href="http://www.rglab.org/pics-and-bioconductor/">developer web site</a>)</p><p>SPP: <a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/">ChIP-seq processing pipeline</a></p><p><a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/tutorial.html">SPP Tutorial</a></p><p><a href="http://liulab.dfci.harvard.edu/MACS/index.html">MACS</a></p><p><a href="http://gmdd.shgmo.org/Computational-Biology/ChIP-Seq/download/SIPeS">SIPeS</a></p><h3><a name="TOC-RNA-Seq-Analysis" id="TOC-RNA-Seq-Analysis"></a>RNA-Seq Analysis</h3><h4><a name="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-" id="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-"></a>Counting Reads that Overlap with Annotation Ranges&nbsp;</h4><p>The GenomicRanges package provides support for importing into R short read alignment data in BAM format (via Rsamtools) and associating them with genomic feature ranges, such as exons or genes. This way one can quantify the number of reads aligning to annotated genomic regions. The package defines general purpose containers for storing genomic intervals as well as more specialized containers for storing alignments against a reference genome. The two main functions for read counting provided by this infrastructure are <span>countOverlaps <span style="color: #000000;"><span>and</span></span> summarizeOverlaps</span>. For their proper usage, it is important to read the corresponding <a href="http://www.bioconductor.org/packages/devel/bioc/vignettes/GenomicRanges/inst/doc/summarizeOverlaps.pdf">PDF manual</a>. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-DESeq" id="TOC-Differential-Gene-Expression-Analysis-with-DESeq"></a>Differential Gene Expression Analysis with DESeq</h4><p>The DESeq package contains functions to call differentially expressed genes (DEGs) in count tables based on a model using the negative binomial distribution. It expects as input a data frame with the raw read counts per region/gene of interest (rows) for each test sample (columns).&nbsp; Such a count table can be imported into R or generated from BAM alignment files using the <span>countOverlaps</span> function as introduced above. <a href="http://www.bioconductor.org/packages/release/bioc/html/DESeq.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-edgeR" id="TOC-Differential-Gene-Expression-Analysis-with-edgeR"></a>Differential Gene Expression Analysis with edgeR</h4><p>The edgeR package uses empirical Bayes estimation and exact tests based on the negative binomial distribution to call differentially expressed genes (DEGs) in count data.&nbsp;</p>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/edgeR.html">Documentation</a></p>
<p><span style="color: #000000;">A variety of additional R packages are available for normalizing RNA-Seq read count data and identifying differentially expressed genes (DEG): <br /> </span></p><p><a href="http://bioconductor.org/packages/devel/bioc/html/easyRNASeq.html">easyRNASeq</a> (simplifies read counting per genome feature)</p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/DEXSeq.html">DEXSeq</a> (Inference of differential exon usage);&nbsp;<a href="http://www.bioconductor.org/packages/release/data/experiment/html/parathyroidSE.html">parathyroidSE</a> explains how to generate exon read counts in R</p><p><a href="http://bioconductor.org/packages/release/bioc/html/DEGseq.html">DEGseq</a></p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/baySeq.html">baySeq</a> (also see: <a href="http://www.bioconductor.org/packages/release/bioc/html/segmentSeq.html">segmentSeq</a>)</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a> (<a href="http://www.hubmed.org/display.cgi?uids=20167110">Bullard et al. 2010</a>)</p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-Detection-of-Alternative-Splice-Junctions" id="TOC-Detection-of-Alternative-Splice-Junctions"></a>Detection of Alternative Splice Junctions</h4>
<p><span style="color: #000000;">Another utility of RNA-Seq experiments is the analysis of splice junctions. The following software suggestions provide this utility:</span></p>
<p><a href="http://woldlab.caltech.edu/rnaseq/">ERANGE<br /> </a><a href="http://tophat.cbcb.umd.edu/">TopHat</a></p><p><a href="http://biogibbs.stanford.edu/%7Ekinfai/SpliceMap/">SpliceMap</a></p><p><a href="http://solidsoftwaretools.com/gf/project/splitseek/">SplitSeek</a></p><h3><a name="TOC-DNA-Methylation-Data-Analysis" id="TOC-DNA-Methylation-Data-Analysis"></a>DNA-Methylation Data Analysis</h3><div><ul>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/help/course-materials/2012/BiocEurope2012/mattia_pelizzola_methylPipe.pdf">methylPipe</a></span></li>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/packages/devel/bioc/html/bsseq.html">bsseq</a></span></li>
<li><a href="http://www.bioconductor.org/packages/devel/bioc/html/BiSeq.html">BiSeq</a></li>
<li>Much more under <a href="http://www.bioconductor.org/packages/devel/BiocViews.html#___DNAMethylation">BiocViews</a></li>
</ul></div></div></div><h3><a name="TOC-HT-Seq-Data-Visualization" id="TOC-HT-Seq-Data-Visualization"></a>HT-Seq Data Visualization</h3>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/ggbio.html">ggbio</a>: ggplot2 extension for genomics data (<a href="http://tengfei.github.com/ggbio/">online manual</a>) <a href="http://www.bioconductor.org/packages/devel/bioc/html/Gviz.html">Gviz</a>:&nbsp;Plotting data and annotation information along genomic coordinates <a href="http://bioconductor.org/packages/release/bioc/html/HilbertVis.html">HilbertVis</a>: Hilbert genome plots</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/GenomeGraphs.html">GenomeGraphs</a>: Plotting genomic information from Ensembl</p><p><a href="http://www.hubmed.org/display.cgi?uids=18507856">TileQC</a>: Flow Cell Quality Visualization</p><p><a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">rtracklayer</a>: R interface to genome browsers</p><p><a href="http://genoplotr.r-forge.r-project.org/">genoPlotR</a>: Plotting maps of genes and genomes</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a>: Tools for storing, accessing, analyzing and visualizing genomic data.</p><p>&nbsp;</p><p>To install all packages</p><blockquote><p>source("http://bioconductor.org/biocLite.R")<br />biocLite()<br />biocLite(c("ShortRead", "Biostrings", "IRanges", "BSgenome", "rtracklayer", "biomaRt", "chipseq", "ChIPpeakAnno", "Rsamtools", "BayesPeak", "PICS", "GenomicRanges", "DESeq", "edgeR", "leeBamViews", "GenomicFeatures", "BSgenome.Celegans.UCSC.ce2"))</p></blockquote></div>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</guid>
	<pubDate>Tue, 07 Aug 2018 10:01:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</link>
	<title><![CDATA[VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements]]></title>
	<description><![CDATA[<p>VCFtools contains a Perl API (<a href="http://vcftools.sourceforge.net/perl_module.html#Vcf.pm">Vcf.pm</a>) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the&nbsp;<strong>--help</strong>&nbsp;switch to obtain more help.</p>
<p>Many of the&nbsp;<strong>Perl scripts require that the VCF files are compressed by&nbsp;<span>bgzip</span>&nbsp;and indexed by&nbsp;<span>tabix</span></strong>&nbsp;(both tools are part of the tabix package, available for&nbsp;<a href="https://sourceforge.net/projects/samtools/files/tabix/">download here</a>). The VCF files can be compressed and indexed using the following commands</p>
<p>bgzip my_file.vcf<br>tabix -p vcf my_file.vcf.gz</p>
<p>&nbsp;</p>
<p>http://vcftools.sourceforge.net/perl_module.html</p><p>Address of the bookmark: <a href="http://vcftools.sourceforge.net/perl_module.html" rel="nofollow">http://vcftools.sourceforge.net/perl_module.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/19792/irishgrid-irish-grid-mapping-system</guid>
	<pubDate>Fri, 26 Dec 2014 07:53:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/19792/irishgrid-irish-grid-mapping-system</link>
	<title><![CDATA[irishgrid: Irish Grid Mapping System]]></title>
	<description><![CDATA[<p>Perl module for creating geographic 10km-square maps using either SVG or PNG (with GD library) output format.</p>
<p>Originally design to map the location of objects in a 10 km map IrishGrid includes:</p>
<ul>
<li>native support of the Irish Grid System (see <a href="http://www.osi.ie/">http://www.osi.ie/</a>)</li>
<li>optimize for speed (there's as less as possible data to conversion)</li>
<li>customized color functions</li>
</ul>
<p>https://code.google.com/p/irishgrid/downloads/detail?name=irishgrid.pl</p><p>Address of the bookmark: <a href="https://code.google.com/p/irishgrid/" rel="nofollow">https://code.google.com/p/irishgrid/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>