<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29487?offset=1000</link>
	<atom:link href="https://bioinformaticsonline.com/related/29487?offset=1000" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44713/understanding-rna-seq-normalization-methods-tpm-vs-fpkm-vs-cpm</guid>
	<pubDate>Wed, 11 Dec 2024 00:59:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44713/understanding-rna-seq-normalization-methods-tpm-vs-fpkm-vs-cpm</link>
	<title><![CDATA[Understanding RNA-Seq Normalization Methods: TPM vs. FPKM vs. CPM]]></title>
	<description><![CDATA[<p>RNA sequencing (RNA-Seq) is a powerful technology used to study transcriptomes, providing insights into gene expression levels. However, raw RNA-Seq data requires normalization to account for sequencing depth and gene length, enabling accurate comparisons between genes and samples. Among the most widely used normalization methods are TPM (Transcripts Per Million), FPKM (Fragments Per Kilobase Million), and CPM (Counts Per Million). Each method has its unique principles and applications, which we&rsquo;ll explore in this blog.</p><h2>Why Normalize RNA-Seq Data?</h2><p>Normalization is a crucial step in RNA-Seq analysis for the following reasons:</p><ul>
<li>
<p><strong>Sequencing depth:</strong> Different RNA-Seq experiments produce varying numbers of reads, making direct comparisons between samples misleading.</p>
</li>
<li>
<p><strong>Gene length:</strong> Longer genes inherently generate more reads, irrespective of their actual expression level.</p>
</li>
<li>
<p><strong>Bias reduction:</strong> Normalization mitigates technical biases, enabling meaningful biological interpretation.</p>
</li>
</ul><h2>TPM (Transcripts Per Million)</h2><p>TPM measures the proportion of reads mapped to a transcript, normalized by transcript length and sequencing depth. It is calculated as:</p><h3>Key Features:</h3><ol>
<li>
<p><strong>Proportionality:</strong> TPM values sum to 1,000,000 across all transcripts in a sample, making it easier to compare between samples.</p>
</li>
<li>
<p><strong>Intuitive interpretation:</strong> TPM values directly represent the abundance of transcripts in a sample.</p>
</li>
<li>
<p><strong>Preferred for comparisons:</strong> TPM facilitates between-sample comparisons better than FPKM.</p>
</li>
</ol><h2>FPKM (Fragments Per Kilobase Million)</h2><p>FPKM normalizes read counts by transcript length and sequencing depth, but without enforcing proportionality like TPM. It is defined as:</p><h3>Key Features:</h3><ol>
<li>
<p><strong>Historical significance:</strong> FPKM was one of the first normalization methods used for RNA-Seq.</p>
</li>
<li>
<p><strong>Single-end vs. paired-end:</strong> In paired-end sequencing, FPKM becomes RPKM (Reads Per Kilobase Million).</p>
</li>
<li>
<p><strong>Limited utility:</strong> FPKM values are not as robust as TPM for cross-sample comparisons due to lack of proportionality.</p>
</li>
</ol><h2>CPM (Counts Per Million)</h2><p>CPM normalizes raw read counts by sequencing depth, without considering gene length. It is expressed as:</p><h3>Key Features:</h3><ol>
<li>
<p><strong>Simplicity:</strong> CPM is straightforward and computationally less intensive.</p>
</li>
<li>
<p><strong>Application:</strong> Suitable for non-length-dependent analyses, such as comparing total expression levels or differential expression analysis.</p>
</li>
<li>
<p><strong>Gene length agnostic:</strong> CPM does not correct for gene length, making it less ideal for measuring expression levels.</p>
</li>
</ol><h2>When to Use Each Method</h2><ul>
<li>
<p><strong>TPM:</strong> Best for comparing expression levels between samples, especially when transcript length and sequencing depth vary.</p>
</li>
<li>
<p><strong>FPKM:</strong> Useful for historical consistency but generally replaced by TPM.</p>
</li>
<li>
<p><strong>CPM:</strong> Ideal for differential expression analysis when gene length normalization is unnecessary.</p>
</li>
</ul><h2>Conclusion</h2><p>Choosing the right normalization method depends on the specific objectives of your RNA-Seq analysis. TPM&rsquo;s proportionality and robustness make it the preferred choice for most applications, while CPM serves well for differential expression studies. Although FPKM paved the way for RNA-Seq normalization, it has largely been supplanted by TPM in modern workflows. Understanding these methods and their nuances ensures accurate and meaningful interpretations of RNA-Seq data.</p><h3>References:</h3><ol>
<li>
<p>Li, B., &amp; Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. <em>BMC Bioinformatics.</em></p>
</li>
<li>
<p>Trapnell, C., et al. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. <em>Nature Biotechnology.</em></p>
</li>
<li>
<p>Law, C. W., et al. (2014). voom: precision weights unlock linear model analysis tools for RNA-seq read counts. <em>Genome Biology.</em></p>
</li>
</ol>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35550/circoletto-visualizing-sequence-similarity-with-circos</guid>
	<pubDate>Fri, 09 Feb 2018 10:23:40 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35550/circoletto-visualizing-sequence-similarity-with-circos</link>
	<title><![CDATA[Circoletto: visualizing sequence similarity with Circos]]></title>
	<description><![CDATA[<p><span>Circoletto, an online visualization tool based on Circos, which provides a fast, aesthetically pleasing and informative overview of sequence similarity search results.</span></p>
<p>Online version and downloadable software package for offline use (source code in PERL) freely available at&nbsp;<a href="http://bat.ina.certh.gr/tools/circoletto/" target="">http://bat.ina.certh.gr/tools/circoletto/</a></p>
<p><strong>Contact:</strong><a href="mailto:ndarz@certh.gr" target="">ndarz@certh.gr</a></p><p>Address of the bookmark: <a href="http://tools.bat.infspire.org/circoletto/" rel="nofollow">http://tools.bat.infspire.org/circoletto/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

</channel>
</rss>