<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29487?offset=180</link>
	<atom:link href="https://bioinformaticsonline.com/related/29487?offset=180" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31064/cgaln</guid>
	<pubDate>Wed, 22 Feb 2017 05:14:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31064/cgaln</link>
	<title><![CDATA[Cgaln]]></title>
	<description><![CDATA[<p>Cgaln (Coarse grained alignment) is a program designed to align a pair of whole genomic sequences of not only bacteria but also entire chromosomes of vertebrates on a nominal desktop computer. Cgaln performs an alignment job in two steps, at the block level and then at the nucleotide level. The former "coarse-grained" alignment can explore genomic rearrangements and reduce the regions to be analyzed in the next step. The latter is devoted to detailed alignment within the limited regions found in the first stage. The output of Cgaln is 'glocal' in the sense that rearrangements are taken into consideration while each alignable region is extended as long as possible. Thus, Cgaln is not only fast and memory-efficient, but also can filter noisy outputs without missing the most important homologous segment pairs.</p>
<p>http://www.iam.u-tokyo.ac.jp/chromosomeinformatics/rnakato/cgaln/</p><p>Address of the bookmark: <a href="http://www.iam.u-tokyo.ac.jp/chromosomeinformatics/rnakato/cgaln/" rel="nofollow">http://www.iam.u-tokyo.ac.jp/chromosomeinformatics/rnakato/cgaln/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29693/bioistats-online-course</guid>
	<pubDate>Thu, 10 Nov 2016 04:22:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29693/bioistats-online-course</link>
	<title><![CDATA[Bioistats Online course]]></title>
	<description><![CDATA[<p><span>One of our primary focuses will be to develop an understanding of the various ways in which we can assign a probability to some chance event. We'll also learn the&nbsp;</span><strong>fundamental&nbsp;</strong><span><strong>properties of probability</strong>, investigate how probability behaves, and learn how to calculate the probability of a new chance event.</span></p>
<p><span>This book is handy understanding basic concepts.</span></p><p>Address of the bookmark: <a href="https://onlinecourses.science.psu.edu/stat414/node/287" rel="nofollow">https://onlinecourses.science.psu.edu/stat414/node/287</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31209/dial</guid>
	<pubDate>Wed, 01 Mar 2017 08:42:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31209/dial</link>
	<title><![CDATA[DIAL]]></title>
	<description><![CDATA[<p>A computational pipeline for identifying single-base substitutions between two closely related genomes without the help of a reference genome. DIAL works even when the depth of coverage is insufficient for de novo assembly, and it can be extended to determine small insertions/deletions. Our main motivation is to use this tool to survey the genetic diversity of endangered species as the identified sequence differences can be used to design genotyping arrays to assist in the species' management.</p>
<p>http://www.bx.psu.edu/~ratan/</p><p>Address of the bookmark: <a href="http://www.bx.psu.edu/miller_lab/" rel="nofollow">http://www.bx.psu.edu/miller_lab/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30459/prodigal-prokaryotic-dynamic-programming-genefinding-algorithm</guid>
	<pubDate>Thu, 29 Dec 2016 03:26:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30459/prodigal-prokaryotic-dynamic-programming-genefinding-algorithm</link>
	<title><![CDATA[Prodigal (Prokaryotic Dynamic Programming Genefinding Algorithm)]]></title>
	<description><![CDATA[<p><span>Prodigal (</span><strong>Pro</strong><span>karyotic&nbsp;</span><strong>Dy</strong><span>namic Programming&nbsp;</span><strong>G</strong><span>enefinding&nbsp;</span><strong>Al</strong><span>gorithm) is a microbial (bacterial and archaeal) gene finding program developed at Oak Ridge National Laboratory and the University of Tennessee. Key features of Prodigal include:</span></p>
<ul>
<li><strong>Speed</strong>: Prodigal is an extremely fast gene recognition tool (written in very vanilla C). It can analyze an entire microbial genome in 30 seconds or less.</li>
<li><strong>Accuracy</strong>: Prodigal is a highly accurate gene finder. It correctly locates the 3' end of every gene in the experimentally verified Ecogene data set (except those containing introns). It possesses a very sophisticated ribosomal binding site scoring system that enables it to locate the translation initiation site with great accuracy (96% of the 5' ends in the Ecogene data set are located correctly).</li>
<li><strong>Specificity</strong>: Prodigal's false positive rate compares favorably with other gene identification programs, and usually falls under 5%.</li>
<li><strong>GC-Content Indifferent</strong>: Prodigal performs well even in high GC genomes, with over a 90% perfect match (5'+3') to the&nbsp;<em>Pseudomonas aeruginosa</em>&nbsp;curated annotations.</li>
<li><strong>Metagenomic Version</strong>: Prodigal can run in metagenomic mode and analyze sequences even when the organism is unknown.</li>
<li><strong>Ease of Use</strong>: Prodigal can be run in one step on a single genomic sequence or on a draft genome containing many sequences. It does not need to be supplied with any knowledge of the organism, as it learns all the properties it needs to on its own.</li>
<li><strong>Open Source</strong>: Prodigal source code is freely available under the General Public License.</li>
</ul>
<p>&nbsp;</p>
<div style="text-align: center;"><strong>Download the latest version of Prodigal at&nbsp;<a href="http://github.com/hyattpd/prodigal/releases/">the Prodigal github page.</a></strong>&nbsp;<br>or&nbsp;<br><strong>Browse the&nbsp;<a href="http://github.com/hyattpd/prodigal/wiki">wiki documenation.</a></strong>&nbsp;</div><p>Address of the bookmark: <a href="http://prodigal.ornl.gov/" rel="nofollow">http://prodigal.ornl.gov/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31714/krona</guid>
	<pubDate>Wed, 22 Mar 2017 04:47:35 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31714/krona</link>
	<title><![CDATA[Krona]]></title>
	<description><![CDATA[<p>Krona allows hierarchical data to be explored with zooming, multi-layered pie charts. Krona charts can be created using an <a href="https://github.com/marbl/Krona/wiki/ExcelTemplate">Excel template</a> or <a href="https://github.com/marbl/Krona/wiki/KronaTools">KronaTools</a>, which includes support for several bioinformatics tools and raw data formats. The interactive charts are self-contained and can be viewed with any modern web browser (see <a href="https://github.com/marbl/Krona/wiki/Browser%20support">Browser support</a>).</p>
<p><a href="http://marbl.github.io/Krona/img/screen_mgrast.png"><img src="https://camo.githubusercontent.com/27b71b1f1832523723c3d14dec764e7ad098438c/687474703a2f2f6d6172626c2e6769746875622e696f2f4b726f6e612f696d672f7468756d625f6d67726173742e706e67" width="210" height="167" alt="image" style="border: 0px;"></a></p><p>Address of the bookmark: <a href="https://github.com/marbl/Krona/wiki" rel="nofollow">https://github.com/marbl/Krona/wiki</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32420/fastq-format</guid>
	<pubDate>Wed, 03 May 2017 04:23:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32420/fastq-format</link>
	<title><![CDATA[Fastq format]]></title>
	<description><![CDATA[<p><strong>FASTQ format</strong>&nbsp;is a text-based&nbsp;<a href="https://en.wikipedia.org/wiki/File_format" title="File format">format</a>&nbsp;for storing both a biological sequence (usually&nbsp;<a href="https://en.wikipedia.org/wiki/Nucleotide_sequence" title="Nucleotide sequence">nucleotide sequence</a>) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single&nbsp;<a href="https://en.wikipedia.org/wiki/ASCII" title="ASCII">ASCII</a>&nbsp;character for brevity.</p>
<p>It was originally developed at the&nbsp;<a href="https://en.wikipedia.org/wiki/Wellcome_Trust_Sanger_Institute" title="Wellcome Trust Sanger Institute">Wellcome Trust Sanger Institute</a>&nbsp;to bundle a&nbsp;<a href="https://en.wikipedia.org/wiki/FASTA_format" title="FASTA format">FASTA</a>&nbsp;sequence and its quality data, but has recently become the&nbsp;<em>de facto</em>&nbsp;standard for storing the output of high-throughput sequencing instruments such as the&nbsp;<a href="https://en.wikipedia.org/wiki/Illumina_(company)" title="Illumina (company)">Illumina</a>&nbsp;Genome Analyzer.<sup id="cite_ref-Cock2009_1-0"><a href="https://en.wikipedia.org/wiki/FASTQ_format#cite_note-Cock2009-1">[1]</a></sup></p><p>Address of the bookmark: <a href="https://en.wikipedia.org/wiki/FASTQ_format" rel="nofollow">https://en.wikipedia.org/wiki/FASTQ_format</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32048/json</guid>
	<pubDate>Tue, 04 Apr 2017 08:02:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32048/json</link>
	<title><![CDATA[JSON]]></title>
	<description><![CDATA[<p><strong>JSON</strong>&nbsp;(JavaScript Object Notation) is a lightweight data-interchange format. It is easy for humans to read and write. It is easy for machines to parse and generate. It is based on a subset of the&nbsp;<a href="http://javascript.crockford.com/">JavaScript Programming Language</a>,&nbsp;<a href="http://www.ecma-international.org/publications/files/ecma-st/ECMA-262.pdf">Standard ECMA-262 3rd Edition - December 1999</a>. JSON is a text format that is completely language independent but uses conventions that are familiar to programmers of the C-family of languages, including C, C++, C#, Java, JavaScript, Perl, Python, and many others. These properties make JSON an ideal data-interchange language.</p>
<p>JSON is built on two structures:</p>
<ul>
<li>A collection of name/value pairs. In various languages, this is realized as an&nbsp;<em>object</em>, record, struct, dictionary, hash table, keyed list, or associative array.</li>
<li>An ordered list of values. In most languages, this is realized as an&nbsp;<em>array</em>, vector, list, or sequence.</li>
</ul>
<p>These are universal data structures. Virtually all modern programming languages support them in one form or another. It makes sense that a data format that is interchangeable with programming languages also be based on these structures.</p><p>Address of the bookmark: <a href="http://json.org/" rel="nofollow">http://json.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32849/car-reconstructing-contiguous-regions-of-an-ancestral-genome</guid>
	<pubDate>Thu, 18 May 2017 05:24:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32849/car-reconstructing-contiguous-regions-of-an-ancestral-genome</link>
	<title><![CDATA[CAR: Reconstructing Contiguous Regions of an Ancestral Genome]]></title>
	<description><![CDATA[<div id="abstract-1">
<p id="p-5">We describe a new method for predicting the ancestral order and orientation of those intervals from their observed adjacencies in modern species. We combine the results from this method with data from chromosome painting experiments to produce a map of an early mammalian genome that accounts for 96.8% of the available human genome sequence data. The precision is further increased by mapping inversions as small as 31 bp. Analysis of the predicted evolutionary breakpoints in the human lineage confirms certain published observations but disagrees with others. Although only a few mammalian genomes are currently sequenced to high precision, our theoretical analyses and computer simulations indicate that our results are reasonably accurate and that they will become highly accurate in the foreseeable future. Our methods were developed as part of a project to reconstruct the genome sequence of the last ancestor of human, dogs, and most other placental mammals;</p>
</div><p>Address of the bookmark: <a href="http://www.bx.psu.edu/miller_lab/car/" rel="nofollow">http://www.bx.psu.edu/miller_lab/car/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32465/tetra-nucleotide-analysis</guid>
	<pubDate>Thu, 04 May 2017 05:07:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32465/tetra-nucleotide-analysis</link>
	<title><![CDATA[Tetra-Nucleotide Analysis]]></title>
	<description><![CDATA[<p>A tetra-nucleotide is a fragment of DNA sequence with 4 bases (e.g. AGTC or TTGG). Pride&nbsp;<em>et al.</em>&nbsp;(2003) showed that the frequency of tetra-nucleotides in bacterial genomes contain useful, albeit weak, phylogenetic signals. Even though tetra-nucleotide analysis (TNA) utilizes the information of whole genome, it is evident that it cannot replace other alignment-based phylogenetic methods such as&nbsp;<a href="https://chunlab.wordpress.com/orthoani/">OrthoANI</a>&nbsp;or&nbsp;16S rRNA phylogeny. However, TNA can be useful for&nbsp;phylogenetic characterization when whole genome or 16S rRNA gene information is not available. For example, a partial genomic fragment obtained from a metagenome can be identified by TNA (Teeling&nbsp;<em>et al.</em>, 2004). TNA is also fast enough that it can be&nbsp;used&nbsp;as a search engine against a large genome database.</p><p>Address of the bookmark: <a href="https://chunlab.wordpress.com/tetra-nucleotide-analysis/" rel="nofollow">https://chunlab.wordpress.com/tetra-nucleotide-analysis/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>