BOL: Related items

Experimental Scientific Officer (Bioinformatics)

Fri, 27 Sep 2013 11:09:44 -0500

Closing Date: 8 October 2013

Salary: £27,854 - £29,541, with progression to £36,298

You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.

You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.

This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.

Tenable for three years.

Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk

For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&jobid=50667,2552984041&key=70203469&c=725434237887&pagestamp=sepghtjhowdqpsxuyn

You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Paolo Ruggerone Lab

Tue, 01 Oct 2013 14:15:53 -0500

Efflux pumps (RND family)

Functioning of efflux systems in Gram-negative bacteria
Determinants of the compound-efflux system interactions
Action of inhibitors on efflux systems
Structural and dynamical features of the efflux systems

TatA
Assembly of the TatA system
Study of the dynamical features of the charge zipper

Methods
Setup of a kinetic Monte Carlo (KMC) scheme to study the flux of antibiotics through porins and efflux systems
Setup of protocol to integrate MD results in a ligand-based approach

Viral inhibitors
Interactions of selected compounds with RNA-dependent RNA polymerases (RdRps) of HCV and BVDV
Assessment of the role of mutations in RdRps
Antimicrobial peptides

Interactions of antimicrobial peptides with membranes: structure and dynamics
Interactions between antimicrobial peptides in the presence of different membranes
Protein-protein interactions
Effects of mutations

Lab Page
http://www.dsf.unica.it/~paolo/Site/Home.html

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

Bergman Lab

Thu, 03 Oct 2013 17:20:09 -0500

Broad area of research:

Genome Annotation and Functional Genomics

Bergman Lab is actively engaged in the development and application of computational methods to improve the annotation of functional biological features in genome sequences. Bergman Lab work focuses on improving annotation of non-protein-coding regions of the genome including conserved noncoding sequences (CNSs), cis-regulatory modules (CRMs), transcription factor binding sites (TFBSs), transposable elements (TEs) and noncoding RNA (ncRNA) genes. Current projects include improving the (i) annotation of TEs in the fly and yeast genomes, (ii) annotation of CRMs and TFBSs in the fly genome, and (iii) analysis of transposon knockout collections in flies. Research in this area is supported by the EC FP7 programme.

Genome and Molecular Evolution
Text and Data Mining

More @ http://bergmanlab.smith.man.ac.uk/

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

The anatomy of successful computational biology software

Jitendra Narayan — Thu, 10 Oct 2013 11:53:08 -0500

Creators of software widely used in computational biology discuss the factors that contributed to their success

Nature Biotechnology spoke with Altschul and several other originators of computational biology software programs widely used today (Table 1). The conversations explored what makes certain software tools successful, the unique challenges of developing them for biological research and how the field of computational biology, as a whole, can move research agendas forward. What follows is an edited compilation of interviews.

Detail @ http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html

News Source @ Nature

Network Analysis @ Indian Statistical Institute

Wed, 16 Oct 2013 08:06:50 -0500

Indian Statistical Institute Kolkata invites applications for the following posts

2013 Oct Advertisement from Indian Statistical Institute

Post: Network Analysis

No. of Positions: 01

Educational Qualifications:

Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class
Experience:

(details of experience required)
Pay Scale: INR Rs.16000-20000/-P.M.

Walk-In-Interview : 22 Oct 2013 at 10:30 AM

Download Official Notification:
http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf

DeepHiC: A Generative Adversarial Network for Enhancing Hi-C Data Resolution

Rahul Nayak — Tue, 03 Mar 2020 01:12:47 -0600

DeepHiC is a GAN-based model for enhancing Hi-C data resolution. We developed this server for helping researchers to enhance their own low-resolution data by a few steps of clicks. Ab initio training could be performed according to our published code. We provided trained models for various depth of low-coverage sequencing Hi-C data. The depth of input data is estimated by its distribution comparing with those of the downsampled Hi-C data we used in training

Address of the bookmark: http://sysomics.com/deephic

Troyanskaya Lab

Fri, 18 Oct 2013 10:57:40 -0500

In our research, we combine computational methods with an experimental component in a unified effort to develop comprehensive descriptions of genetic systems of cellular controls, including those whose malfunctioning becomes the basis of genetic disorders, such as cancer, and others whose failure might produce developmental defects in model systems.

Research Interest
Genomic Data Integration

Microarray Analysis

Gene and Protein Function Prediction

Detection and Analysis of Chromosomal Abnormalities and Functional Evolution

Integration of Computation and Experiments

Identification of Biological Networks and Pathways

Evaluation and Validation of Computational Predictions

Scalable Visualization-Based Data Analysis

More @ http://reducio.princeton.edu/cm/
PI page @ http://reducio.princeton.edu/cm/ogt