BOL: Related items

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

The anatomy of successful computational biology software

Jitendra Narayan — Thu, 10 Oct 2013 11:53:08 -0500

Creators of software widely used in computational biology discuss the factors that contributed to their success

Nature Biotechnology spoke with Altschul and several other originators of computational biology software programs widely used today (Table 1). The conversations explored what makes certain software tools successful, the unique challenges of developing them for biological research and how the field of computational biology, as a whole, can move research agendas forward. What follows is an edited compilation of interviews.

Detail @ http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html

News Source @ Nature

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch

Network Analysis @ Indian Statistical Institute

Wed, 16 Oct 2013 08:06:50 -0500

Indian Statistical Institute Kolkata invites applications for the following posts

2013 Oct Advertisement from Indian Statistical Institute

Post: Network Analysis

No. of Positions: 01

Educational Qualifications:

Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class
Experience:

(details of experience required)
Pay Scale: INR Rs.16000-20000/-P.M.

Walk-In-Interview : 22 Oct 2013 at 10:30 AM

Download Official Notification:
http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf

VG: variation graph data structures, interchange formats, alignment, genotyping, and variant calling methods

Jit — Tue, 28 Jan 2020 03:53:24 -0600

Variation graphs provide a succinct encoding of the sequences of many genomes. A variation graph (in particular as implemented in vg) is composed of:

nodes, which are labeled by sequences and ids
edges, which connect two nodes via either of their respective ends
paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

Troyanskaya Lab

Fri, 18 Oct 2013 10:57:40 -0500

In our research, we combine computational methods with an experimental component in a unified effort to develop comprehensive descriptions of genetic systems of cellular controls, including those whose malfunctioning becomes the basis of genetic disorders, such as cancer, and others whose failure might produce developmental defects in model systems.

Research Interest
Genomic Data Integration

Microarray Analysis

Gene and Protein Function Prediction

Detection and Analysis of Chromosomal Abnormalities and Functional Evolution

Integration of Computation and Experiments

Identification of Biological Networks and Pathways

Evaluation and Validation of Computational Predictions

Scalable Visualization-Based Data Analysis

More @ http://reducio.princeton.edu/cm/
PI page @ http://reducio.princeton.edu/cm/ogt

Collection of Graph Visualization tools !

Neel — Wed, 25 Jan 2023 02:57:42 -0600

Standard approaches to genome inference and analysis relate sequences to a single linear reference genome. This is efficient but has a fundamental problem: Differences from this reference are hard to observe and describe in a coherent way. Variation and sequence are separated.

https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/

Address of the bookmark: https://pangenome.github.io/

Assistant Professor in Molecular Synthesis for Drug Discovery and Development @ CBMR, Lucknow

Wed, 30 Oct 2013 06:42:27 -0500

ADVERTISEMENT FOR FACULTY POSITIONS AT CENTRE OF BIOMEDICAL RESEARCH (CBMR), LUCKNOW

Details of the Positions and Pay Structure:

03 Posts for Assistant Professor in Molecular Synthesis for Drug Discovery and Development

Essential Qualifications and Requirements:

1. PhD in Synthetic Organic Chemistry/Medicinal Chemistry with research publications in high quality international journals and first class grade at the preceding degree from recognised University/Institute in India or abroad with consistently good academic record.
2. Three Yrs of Post-doctoral experience in relevant area.
3. Below 35 Yrs of age at the time of application

Desirable Experience: Candidates having strong research background in organic synthesis, total synthesis of structurally complex and medicinally important natural products/drugs related to cancer, neurodegenerative diseases (neurotropically active molecules for Alzheimer's, Parkinson’s, dementia etc) and infectious diseases such as malaria, TB etc. will be preferred.

Interested candidates may apply with:

1. Filled up Application Form (download from CBMR Website: http://www.cbmr.res.in) along with the Cover Letter, Curriculum Vitae including academic record (Bachelor degree onwards), awards, honours, list of Publications and reprints of 5 best publications.
2. Proposed research plan (max 3-4 pages).
3. Names and address (with valid e-mail and Phone number) of at least 3 academic referees.
4. Online Payment Receipt with transaction reference no. of Rs. 1000/- (USD 100 or equivalent foreign currency) on following details.
Account Number: 30054847814 Name: Director, Centre of Biomedical Research
Bank: STATE BANK OF INDIA, SGPGI Campus Branch, LUCKNOW

IFSC Code: SBIN0007789
MICR No: 22602034

Applications can be sent by registered/speed post or by e-mail to the following address:

The Director,
Centre of Biomedical Research (CBMR),
Sanjay Gandhi PGI Campus,
Raebareli Road, Lucknow-226014
e-mail: cbmr.admin@cbmr.res.in,
gp.pandey@cbmr.res.in

More Info:

http://www.cbmr.res.in/career/Advertisement%20for%20the%20post%20of%20Professors%20and%20Assistant%20Professors.pdf

Osprey: Network Visualization System

BioJoker — Sun, 20 Jan 2019 05:34:24 -0600

Osprey is a software platform for the visualization of complex biological interaction networks. Osprey builds data-rich graphical representations from Gene Ontology (GO) annotated interaction data maintained by the BioGRID.

Osprey is developed by the TyersLab and is a part of the BioGRID family of software. It utilizes both MySQL and Java to operate and is compatible with Windows, Linux, and Apple operating systems.

These works were published in Breitkreutz, BJ., Stark, C., Tyers M. "Osprey: A Network Visualization System." Genome Biology 2003 4(3):R22 [Genome Biology] [PDF] [PubMed] and supported by the National Institutes of Health, Canadian Institutes of Health Research, and Genome Canada.

Address of the bookmark: https://osprey.thebiogrid.org/

Junior Bioinformatic position

Wed, 26 Aug 2015 05:35:28 -0500

Junior Bioinformatic position in the laboratory of Inflammation and immunology in cardiovascular pathologies at Humanitas:

We are seeking a highly motivated young PhD student with strong interest in high throughput data analysis.
Detailed descriptions of our recent research activities may be found here:
http://www.humanitas-research.org/condorelli-gianluigi-md-phd/

Position is available starting from October/November. A probationary period of one month will be required.

Please send a CV along with a cover letter stating the reasons for applying and contact details of one or more referees to Dr. Paolo Kunderfranco (paolo.kunderfranco@humanitasresearch.it).