Phone No. 0495 2731 410

WALK -IN- TEST CUM INTERVIEW
Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) & Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.

Research Associate
Date of Interview : 21 -01-2014 at 10.00 A.M
Qualifications :
a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in Bioinformatics as evidenced by publications.
OR Three years research experience after MVSc/MPharm/ME/MTech with Bioinformatics Specialization.
b Desirable: Experience in handling NGS data Programming skills in Python/Bioperl
Emoluments : Rs:22000/- per month + HRA (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.
Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)
Duration of Project : Till the closure of the project.

General Terms and conditions
1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project.
The selected candidate will not have any right for claiming pay scale or absorption
against any regular post being vacant on a later date at this Institute.
2 . No TA/DA will be paid for attending the Interview.
3. Canvassing in any form will lead to cancellation of candidate.
4. The decision of Director, IISR would be final and binding in all aspects.
5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.
6. Candidates who secure the minimum marks prescribed by the Institute in written test only will be eligible for calling for the interview. The number of candidates to be called for the interview will be decided by the Director of the Institute.
7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.

Note: All relevant certificates (in original) and bio data, No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.
Advertisement: http://spicebioinfo.res.in/downloads/DISC-Website.pdf

Address of the bookmark: https://www.biostarhandbook.com/

Salary: £27,854 - £29,541, with progression to £36,298

You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.

You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.

This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.

Tenable for three years.

Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk

For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&jobid=50667,2552984041&key=70203469&c=725434237887&pagestamp=sepghtjhowdqpsxuyn

You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/

https://bioalgorithms.ucsd.edu/research4.html

Functioning of efflux systems in Gram-negative bacteria
Determinants of the compound-efflux system interactions
Action of inhibitors on efflux systems
Structural and dynamical features of the efflux systems

TatA
Assembly of the TatA system
Study of the dynamical features of the charge zipper

Methods
Setup of a kinetic Monte Carlo (KMC) scheme to study the flux of antibiotics through porins and efflux systems
Setup of protocol to integrate MD results in a ligand-based approach

Viral inhibitors
Interactions of selected compounds with RNA-dependent RNA polymerases (RdRps) of HCV and BVDV
Assessment of the role of mutations in RdRps
Antimicrobial peptides

Interactions of antimicrobial peptides with membranes: structure and dynamics
Interactions between antimicrobial peptides in the presence of different membranes
Protein-protein interactions
Effects of mutations

Lab Page
http://www.dsf.unica.it/~paolo/Site/Home.html

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Genome Annotation and Functional Genomics

Bergman Lab is actively engaged in the development and application of computational methods to improve the annotation of functional biological features in genome sequences. Bergman Lab work focuses on improving annotation of non-protein-coding regions of the genome including conserved noncoding sequences (CNSs), cis-regulatory modules (CRMs), transcription factor binding sites (TFBSs), transposable elements (TEs) and noncoding RNA (ncRNA) genes. Current projects include improving the (i) annotation of TEs in the fly and yeast genomes, (ii) annotation of CRMs and TFBSs in the fly genome, and (iii) analysis of transposon knockout collections in flies. Research in this area is supported by the EC FP7 programme.

Genome and Molecular Evolution
Text and Data Mining

More @ http://bergmanlab.smith.man.ac.uk/

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Nature Biotechnology spoke with Altschul and several other originators of computational biology software programs widely used today (Table 1). The conversations explored what makes certain software tools successful, the unique challenges of developing them for biological research and how the field of computational biology, as a whole, can move research agendas forward. What follows is an edited compilation of interviews.

Detail @ http://www.nature.com/nbt/journal/v31/n10/full/nbt.2721.html

News Source @ Nature