<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29586?offset=780</link>
	<atom:link href="https://bioinformaticsonline.com/related/29586?offset=780" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6233/edwards-lab</guid>
  <pubDate>Sun, 10 Nov 2013 15:07:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Edwards Lab]]></title>
  <description><![CDATA[
<p>We study the evolutionary biology of birds and relatives, combining field, museum and genomics approaches to understand the basis of avian diversity, evolution and behavior. Our guiding approaches include population genetics, which provides a quantitative framework for studying speciation, geographic variation and genome evolution; systematics, which acknowledges that the focal species of any study has relatives that are behaviorally and ecologically no less interesting; and natural history, which gives meaning to the genes and genomic patterns we study.</p>

<p>Lab page: http://www.oeb.harvard.edu/faculty/edwards/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6559/ai-cadd-project-kerela-university</guid>
  <pubDate>Tue, 19 Nov 2013 17:48:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Ai-CADD Project @ Kerela University]]></title>
  <description><![CDATA[
<p>Applications are invited for the following Positions in the AiCADD project funded by MHRD Govt of India</p>

<p>Last Date for Submitting Application: 25th November 2013</p>

<p>1. Senior Scientist: (01 position)<br />Pay Scale: Rs.40, 000/-<br />Qualifications:  PhD/ Post Doctoral with Experience in CADD</p>

<p>2. Junior Scientist (10 positions)<br />Pay Scale: Rs. 22,000/-<br />Qualifications: MPhil / Masters Degree in Bioinformatics / Computational Biology / CADD / Ayurveda</p>

<p>3. Technical Assistant (01+01 positions)<br />Pay Scale: Rs.12,000/-<br />Qualifications: 1. BSc Computer Science/ MCA<br />Qualifications: 2. MSc Biotechnology / MSc Microbiology </p>

<p>4. Programmer (01 position)<br />Pay Scale: Rs.20,000/-<br />Qualifications: MSc Computer Science/ MCA / B Tech (Experience in MATLAB, C, C++) Industrial experience is desirable</p>

<p>5. Teaching Assistant (03 positions)<br />Pay Scale: Rs.10,000/-<br />Qualifications: MSc in Bioinformatics </p>

<p>6. Administration Assistant (02 positions)<br />Pay Scale: Rs.8,000/-<br />Qualifications: Degree + PGDCA</p>

<p>The Selection process comprises of written test and interview. Positions are purely temporary (initially for the period of one year) and co-terminus with the project. For more details mail to: cbi.uok [at] gmail.com</p>

<p>More detail @ https://sites.google.com/site/centreforbioinformatics/announcements/applicationsinvitedforapplicationforai-caddproject</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6577/scientist-b-vector-control-research-centre</guid>
  <pubDate>Tue, 19 Nov 2013 21:19:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist-B @ VECTOR CONTROL RESEARCH CENTRE]]></title>
  <description><![CDATA[
<p>VECTOR CONTROL RESEARCH CENTRE<br />(Indian Council of Medical Research)<br />Indira Nagar Medical Complex<br />Puducherry-605006</p>

<p>WALK-IN-INTERVIEW</p>

<p>The following vacancies shall be filled purely on adhoc basis under Non-Institutional adhoc project “Bioinformatics in ICMR Institutes” funded by Indian Council of Medical Research at Vector Control Research Centre, Puducherry, to be renewed annually and filled through Walk-in-Interview as indicated below. Candidates who wish to appear for the Walk-in-Interview can download the application format given in the website of Vector Control Research Centre (www.vcrc.res.in). Duly filled in application along with attested copies of certificate should be submitted at time of interview.</p>

<p>Date &amp; Time : 05.12.2013 at 9.00 AM – Scientist-C (Non-Medical)</p>

<p>05.12.2013 at 1.30 PM – Scientist-B (Non-Medical)<br />06.12.2013 at 9.00 AM – Technical Assistant (Research Assistant)<br />06.12.2013 at 1.30 PM – Multi Tasking Staff (General)</p>

<p>Place : Vector Control Research Centre, Puducherry</p>

<p>Project entitled : Biomedical Informatics Centres of ICMR</p>

<p>1. Scientist - C (Non-Medical) Number of post – ONE</p>

<p>Essential qualification</p>

<p>B.E./ B. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University with 6 years experience in the relevant field  OR</p>

<p>First class Master’s Degree and Ph.D. Degree in Bioinformatics/ Computational Biology from a recognized University OR</p>

<p>First class Master’s Degree in Bioinformatics/ Computational Biology from a recognized University with 4 years R &amp; D experience in the related subjects as mentioned above OR</p>

<p>Second class Master’s Degree + Ph.D. in Bioinformatics/ Computational Biology from a recognized University with 4 years research experience in bio-medical subjects</p>

<p>Age: Not exceeding 40 years Consolidated Salary – Rs.39,960/- p.m. + HRA as<br />admissible </p>

<p>Desirable qualification (i) Post-doctorate in Bioinformatics/ Computational Biology or M.E. / M. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University for candidates with First Class relevant degree.</p>

<p>(ii) Additional post-doctoral research / teaching experience in Bioinformatics/Computational Biology in recognized Institute(s).</p>

<p>(iii) Knowledge of computer applications or data management</p>

<p>Job requirements i) To apply Bioinformatics / Computational Biology tools in understanding interactions between vectors and parasites/ pathogens and target based development of drug / insecticides.</p>

<p>ii) To assist the investigators to carry out genomic studies on parasites/pathogens/vectors of vector borne diseases</p>

<p>Advertisement: http://vcrc.res.in/Adv_Bio13.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6835/roslin-bioinformatics-group</guid>
  <pubDate>Mon, 25 Nov 2013 23:55:25 -0600</pubDate>
  <link></link>
  <title><![CDATA[Roslin Bioinformatics Group]]></title>
  <description><![CDATA[
<p>Roslin Bioinformatics Group</p>

<p>The Law group provides internal Institute-specific development, training and support roles for data manipulation, sequence analysis and any other aspect of the analysis of biological data using computer systems. Additionally we provide databases and applications supporting the international animal science community, particularly tools and resources for genome mapping.</p>

<p>Head: Andy Law. Members: John Bowman (animal facility database applications), Zen Lu (bioinformatics support), Trevor Paterson (software development)</p>

<p>More @ http://www.bioinformatics.ed.ac.uk/groups/roslin-bioinformatics-group</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7569/phd-at-university-of-calgary</guid>
  <pubDate>Fri, 27 Dec 2013 20:24:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[PhD at University of Calgary]]></title>
  <description><![CDATA[
<p>Institution/Company: <br />University of Calgary<br />Location: <br />Calgary, AB<br />Job Description: </p>

<p>Novel diagnostic platform for detection of Osteoarthritis</p>

<p>I invite applications from highly motivated individuals to join my laboratory as a PhD student in Systems Biology at the University of Calgary McCaig Institute for Bone and Joint Health. This project is aimed at characterizing the networks of physical (protein-protein) interactions underlying inflammatory processes in patients with Osteoarthritis and how this differs from patients with Rheumatoid Arthritis and normal individuals. This work will eventually lead to the development of a novel diagnostic platform for the non-invasive and accurate detection of early Osteoarthritis. The selected candidate will use state-of-the-art computational methodologies to systematically analyze proteomic data, and develop /implement new algorithms to identify protein and functional interaction networks from high throughput experimental data. The individual will also benefit by working closely with experts at the UofC and UofA through an AIHS Alberta Osteoarthritis Team Grant which includes experts from all pillars of health research. The candidate will also be supported to attend bioinformatics workshops and conferences to advance and disseminate their research.<br />Qualifications: The ideal candidate will have a Master’s degree in Computational Biology, Bioinformatics, or equivalent with strong background knowledge of the Biological Sciences, Biochemistry, and Microbiology. The individual should additionally have experience in handling high-throughput data sets as well as programming skills. The candidate will be registered as a PhD student in Dr. Krawetz’s laboratory, located in the new state-of-the-art Health Research Innovation Centre at the UofC. The individual will have strong verbal and written skills and the ability to work efficiently in a team environment.</p>

<p>In addition to the outstanding research opportunities available in this setting, students also enjoy the many cultural and sporting amenities provided in the city of Calgary, and can take advantage of the unparalleled skiing and hiking in the Rocky Mountains that are less than an hour away.</p>

<p>Candidates must be academically competitive and will be expected to apply for external funding. The stipend is $25,000/yr. For outstanding PhD students, internal top-up award opportunities are available on a competitive basis. If interested in joining the lab, please contact Dr. Krawetz directly at rkrawetz@ucalgary.ca and provide the following information:</p>

<p>- Short cover letter explaining your interest in the lab<br />- Resume<br />- Scanned copy of transcript or listing of course grades<br />- Names and contact information for two individuals who will be willing to provide letters of reference</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7215/postdoc-positions-in-computational-biology-center-for-genomic-science-milan-italy</guid>
  <pubDate>Thu, 12 Dec 2013 18:34:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoc positions in computational biology - Center for Genomic Science - Milan, Italy]]></title>
  <description><![CDATA[
<p>Job Description: three postdoc positions in computational biology are available at the Center for Genomic Science in Milan (Italy):</p>

<p>- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)<br />- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio</p>

<p>All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.</p>

<p>Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html</p>

<p>Start date: March 1st, 2014</p>

<p>Duration: 1+2 years</p>

<p>Contact Person (Referent): Mattia Pelizzola</p>

<p>Ref. E-Mail: mattia.pelizzola@iit.it</p>

<p>Tel: 0039-02-94375058<br />Group Web Page: http://genomics.iit.it</p>
]]></description>
</item>

</channel>
</rss>