• Function(data, options)

Even quit is a function

• q()

So is help

help(read.table)

Provides the help page for the FUNCTION ‘read.table’

help.search(“t test”)

Searches for help pages that might relate to the phrase ‘t test’

NOTE: quotes are needed for search strings, they are not needed when referring to data objects or function names.

There is a short cut for help,

? shows the help page on a function name, same as help(function)

?read.table

?? searches for help pages on functions, same as help.search(‘phrase’)

??“t test”

Information is usually returned from a function, by default this is printed to screen

read.table(‘data.tsv’)

This can always be stored, we call what it is stored in an ‘object’

mydata

here mydata is an object of type dataframe

Reminder:

• Vector: a list of numbers, equivalent to a column in a table
• Data Frame = a collection of vectors. Equivalent to a table

Hint:

• Up/Down arrow keys can be use to cycle through previous commands

Central University of Jharkhand has been granted funds by the Department of Biotechnology (DBT), Govt. of India to establish “DBT-Boost to CUJ Interdisciplinary Life Sciences Departments for Education and Research” Applications are invited for the Assistant Professor on purely temporary basis. The appointments shall be initially for a period of one year, renewable every year depending on the satisfactory performance, till the end of project.

Position: ASSISTANT PROFESSOR (Total 03)
Salary: 45,000/- (fixed) per month
Essential Qualifications: i. Good academic record with at least 55% marks (or an equivalent grade in a point scale wherever grading system is followed) at the master’s degree level with specialization in Biodiversity and Systematic/ Systems Biology/ Biophysics/ Bioinformatics from an Indian University, or an equivalent degree from an accredited foreign university. ii. Besides fulfilling the above qualifications, the candidates must have cleared the National Eligibility Test (NET) conducted by the UGC, CSIR or similar test accredited by the UGC like SLET/SET. iii. Notwithstanding anything contained in i. and ii. candidates, who are or have been awarded Ph.D Degree in accordance with the University Grants Commission (Minimum Standards and Procedure for Award of Ph.D. Degree) Regulation, 2009, shall be exempted from therequirement of the minimum eligibility condition of NET/SLET/SET for recruitment and appointment of Assistant Professor. iv. NET/SLET/SET shall also not be required for such disciplines for which NET/SLET/SET in not conducted.
Desirable: Preference will be given to candidates having Ph.D in any of the above mentioned areas with NET

IMPORTANT DATES TO REMEMBER :

Last Date to Apply for this job 24/3/2015

REFERENCE:

Central University of Jharkhand (CUJ) Recruitment 2015 – Advt. No.: CUJ/Advt./14-15/15 Date: 26th Feb. 2015.

More at http://cuj.ac.in/careers.php

http://molbiolabccsumrt.webs.com/

Applications are invited for one post of RA in a DBT funded research project “Creation of Bioinformatics Infrastructure Facility (BIF) for the promotion of Biology Teaching through Bioinformatics (BTBI) Scheme of BTISet”.

Candidate should have a Ph.D. degree in Bioinformatics/Biotechnology/Genetics and Plant Breeding with adequate experience in the area of Bioinformatics. If a suitable candidate for the post of RA is not available, a JRF/SRF may be appointed.

Candidate for the post of JRF/SRF should have Master’s degree in relevant subject with adequate experience in the area of Bioinformatics and should be NET/DBT-BINC qualified

Interested candidates may send their bio-data to Prof. H. S. Balyan (hsbalyan@gmail.com) (in exceptional case, bio-data may also be submitted at the time of interview) and attend the interview on Monday, March 30, 2015 at 11:00 AM in the Department of Genetics & Plant Breeding, Ch. Charan Singh University, Meerut. Candidates shall bring their original documents at the time of interview for verification. No interview letters will be issued and no TA/DA will be paid.

Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud.

http://www.tutorialspoint.com/codingground.htm

Address of the bookmark: http://www.tutorialspoint.com/codingground.htm

Employer: Jawaharlal Nehru University
Address: Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067
Email: not mentioned / provided for this job post
URL: http://www.jnu.ac.in/Career/currentjobs.htm
Phone: 011 2674 2575
Skills: not mentioned / required for this job post
Experience: Experience in molecular biology, structural biology and bioinformatics is desired
Education: M.Sc. in any field of life sciences.
Job Location: New Delhi, Delhi, India (View Jobs in New Delhi, Jobs in Delhi, Jobs in India)

Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec

Name of the Post: JRF / SRF / RA

Salary: As per rules

Required Job Profile:

Candidate must possess M.Sc. in any field of life sciences.

Desired Job Profile:

Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.

How to apply:

Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.

Refer to http://www.jnu.ac.in/Career/currentjobs.htm

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}