<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29603?offset=870</link>
	<atom:link href="https://bioinformaticsonline.com/related/29603?offset=870" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/44632/lecturer-uessex-in-evolutionary-biology</guid>
  <pubDate>Tue, 06 Aug 2024 02:41:17 -0500</pubDate>
  <link></link>
  <title><![CDATA[Lecturer @ UEssex in Evolutionary Biology]]></title>
  <description><![CDATA[
<p>The University of Essex, UK, is seeking a Lecturer conducting research in<br />evolutionary biology or a related field. The new Lecturer will join the<br />collegial and supportive environment of the School of Life Sciences,<br />contributing to teaching and leading a research programme, ideally<br />relating to any aspect of evolutionary biology.</p>

<p>Application closing date 16/09/2024</p>

<p>Details of the post and application process can be found at the following<br />url:</p>

<p>https://vacancies.essex.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open?VACANCY_ID=202575WW5Z&amp;WVID=9918109NEm&amp;LANG=USA</p>

<p>Informal enquiries may be made by email to the Head of the School of<br />Life Sciences Prof Terence McGenity at tjmcgen@essex.ac.uk(all formal<br />applications for the post should be made online through the University<br />of Essex website).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</guid>
	<pubDate>Wed, 21 May 2014 12:50:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</link>
	<title><![CDATA[A Brief Bioinformatics Tutorial]]></title>
	<description><![CDATA[<p>This is about how to use a computer to find what is known about a gene of interest and also how to get new insights about it.</p>
<p>The tutorial is divided in three main parts:</p>
<ul>
<li>In the <strong>Sequence </strong>part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.</li>
<li>The <strong>Structure </strong>part is about molecular visualization, homology modeling and structural domain prediction.</li>
<li>In the <strong>Function </strong>part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...</li>
</ul>
<p>During all the three parts, we will use the <em>S. cerevisiae </em>VPS36 protein as an example.</p><p>Address of the bookmark: <a href="http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html" rel="nofollow">http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38489/biotite-a-general-framework-for-computational-biology</guid>
	<pubDate>Mon, 17 Dec 2018 18:52:27 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38489/biotite-a-general-framework-for-computational-biology</link>
	<title><![CDATA[Biotite: A general framework for computational biology]]></title>
	<description><![CDATA[<p><span>The package is open source and freely available at GitHub (</span><span><a href="https://github.com/biotite-dev/biotite" target="_blank">https://github.com/biotite-dev/biotite</a></span><span>). This package is simple to use especially for the beginners in programming and computationally efficient because of the implementation of Numpy and Cython.&nbsp;Biotite consists of four sub packages: sequence, structure, databases, and application. The&nbsp;</span><em>sequence</em><span>&nbsp;and&nbsp;</span><em>structure</em><span>&nbsp;modules serve for the analysis of sequence and structural data analysis respectively,&nbsp;</span><em>database</em><span>&nbsp;downloads files from the other databases such as RCSB PDB, and&nbsp;</span><em>application</em><span>&nbsp;provides interface for external software.&nbsp;</span></p>
<p><span><span>The&nbsp;</span><em>Biotite</em><span>&nbsp;package bundles popular tasks in computational biology into an unifying framework, which is easy to use on the one hand side, but is also computationally efficient due to intensive usage of&nbsp;</span><em>NumPy</em><span>&nbsp;and&nbsp;</span><em>Cython</em><span>. This package focuses on working with sequence and structure data and supports various file formats and analysis and manipulation functions.</span></span></p><p>Address of the bookmark: <a href="https://github.com/biotite-dev/biotite" rel="nofollow">https://github.com/biotite-dev/biotite</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41040/phd-position-in-molecular-cell-biology</guid>
  <pubDate>Sat, 15 Feb 2020 06:09:55 -0600</pubDate>
  <link></link>
  <title><![CDATA[PhD position in Molecular Cell Biology]]></title>
  <description><![CDATA[
<p>https://www.jobvector.de/jobs-stellenangebote/biologie-life-sciences/wissenschaftliche-r-mitarbeiter-in/phd-position-molecular-cell-biology-129604.html?suid=0ec057818886c1eceac674ca3f83943367a6cbe2</p>

<p>Essential experience / qualifications:<br />We are looking for highly motivated candidates holding a Master / Diploma in Biology, Biochemistry, Molecular Medicine or similar; solid knowledge of molecular and cell biological techniques; good English knowledge.</p>

<p>Applications:<br />Please send your application (including CV, letter of motivation, contact information of two references, and list of publication) by 13.03.2020 at the latest to:</p>

<p>Universitätsklinikum Erlangen<br />Chirurgische Klinik<br />Translational Research Center<br />Prof. Dr. rer. nat. Michael Stürzl<br />Schwabachanlage 12<br />91054 Erlangen<br />E-Mail: michael.stuerzl@uk-erlangen.de</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13014/bioinformatics-jrf-vacancy-at-icgeb-new-delhi</guid>
  <pubDate>Wed, 23 Jul 2014 16:07:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF vacancy at ICGEB, New Delhi]]></title>
  <description><![CDATA[
<p>Junior Research Fellow for a DBT sponsored project entitled "Computational and experimental characterization of stage specific arginine methylation in P. falciparum proteome". </p>

<p>Candidates should have a 1st class MSc/MTech/BTech degree in Bioinformatics. Please send complete CV, quoting Application for RMETH-JRF-2014, by email to Dr. Dinesh Gupta: dinesh@icgeb.res.in</p>

<p>Closing date for applications: 6 August 2014</p>

<p>More at http://www.icgeb.org/tl_files/Vacancies/JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44648/modern-statistics-with-r</guid>
	<pubDate>Thu, 22 Aug 2024 04:44:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44648/modern-statistics-with-r</link>
	<title><![CDATA[Modern Statistics with R]]></title>
	<description><![CDATA[<p>This is the online version of the second edition of&nbsp;<em>Modern Statistics with R</em>. It is free to use, and always will be.&nbsp;<a href="https://www.routledge.com/Modern-Statistics-with-R-From-Wrangling-and-Exploring-Data-to-Inference-and-Predictive-Modelling/Thulin/p/book/9781032512440">Printed copies</a>&nbsp;are available from CRC Press.</p>
<p><span>Live&nbsp;<a href="https://statistikakademin.se/in-english-r/">online courses on statistics with R</a></span>&nbsp;based on this book, led by the author, are offered regularly; see&nbsp;<a href="https://statistikakademin.se/in-english-r/">this page</a>&nbsp;for more information and dates.</p>
<p>The past decades have transformed the world of statistical data analysis, with new methods, new types of data, and new computational tools. The aim of&nbsp;<em>Modern Statistics with R</em>&nbsp;is to introduce you to key parts of the modern statistical toolkit. It teaches you:</p>
<ul>
<li><span>Data wrangling</span>&nbsp;- importing, formatting, reshaping, merging, and filtering data in R.</li>
<li><span>Exploratory data analysis</span>&nbsp;- using visualisations and multivariate techniques to explore datasets.</li>
<li><span>Statistical inference</span>&nbsp;- modern methods for testing hypotheses and computing confidence intervals.</li>
<li><span>Predictive modelling</span>&nbsp;- regression models and machine learning methods for prediction, classification, and forecasting.</li>
<li><span>Simulation</span>&nbsp;- using simulation techniques for sample size computations and evaluations of statistical methods.</li>
<li><span>Ethics in statistics</span>&nbsp;- ethical issues and good statistical practice.</li>
<li><span>R programming</span>&nbsp;- writing code that is fast, readable, and (hopefully!) free from bugs.</li>
</ul>
<p>The book includes plenty of examples and more than 200 exercises with worked solutions.&nbsp;<a href="http://www.modernstatisticswithr.com/data.zip">The datasets used for the examples and the exercises can be downloaded here.</a></p><p>Address of the bookmark: <a href="https://www.modernstatisticswithr.com/" rel="nofollow">https://www.modernstatisticswithr.com/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</guid>
	<pubDate>Sat, 31 May 2014 15:41:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</link>
	<title><![CDATA[Linux Sort Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Almost all the scripting languages such as Perl, Python etc have built-in sort, but unfortunately none of them are as flexible as sort command. But one when it come to space efficiency GNU sort stands at the top. It can sort a 20Gb file with less than 2Gb memory. It is not trivial to implement so powerful a sort by yourself.</p><p>sort a space-delimited file based on its first column, then the second if the first is the same, and so on:<br />sort input.txt</p><p>sort a huge file (GNU sort ONLY):<br />sort -S 1500M -t $HOME/tmp input.txt &gt; sorted.txt</p><p>sort starting from the third column, skipping the first two columns:<br />sort +2 input.txt</p><p>sort the second column as numbers, descending order; if identical, sort the 3rd as strings, ascending order:<br />sort -k2,2nr -k3,3 input.txt</p><p>sort starting from the 4th character at column 2, as numbers:<br />sort -k2.4n input.txt</p><p>More Linxu sort command information<br /><br />If you have any sort commands you'd like to share, please add them to our comments section below. For more help, you can also type:<br /><br />man sort<br /><br />or<br /><br />sort --help<br /><br />on your Unix/Linux system.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44362/biostats-book</guid>
	<pubDate>Mon, 14 Aug 2023 03:11:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44362/biostats-book</link>
	<title><![CDATA[Biostats book !]]></title>
	<description><![CDATA[<p>https://practical-stats-med-r.netlify.app/</p><p>Address of the bookmark: <a href="https://practical-stats-med-r.netlify.app/" rel="nofollow">https://practical-stats-med-r.netlify.app/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</guid>
	<pubDate>Mon, 02 Jun 2014 18:03:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</link>
	<title><![CDATA[Next generation sequencing in R or bioconductor environment]]></title>
	<description><![CDATA[<p>There are many R software and bioconductor packages for NGS data analysis, some of them are as follows</p><h3><a name="TOC-Biostrings" id="TOC-Biostrings"></a>Biostrings</h3><p>The Biostrings package from Bioconductor provides an advanced environment for efficient sequence management and analysis in R. It contains many speed and memory effective string containers, string matching algorithms, and other utilities, for fast manipulation of large sets of biological sequences. The objects and functions provided by Biostrings form the basis for many other sequence analysis packages. <a href="http://bioconductor.org/packages/release/bioc/html/Biostrings.html">Documentation</a></p><div><div style="text-align: left;"><div style="color: #000000;"><h4><a name="TOC-IRanges-Overview" id="TOC-IRanges-Overview"></a>IRanges Overview</h4><p>IRanges provides the low-level infrastructure and containers for handling sets of integer ranges within Bioconductor's BioC-Seq domain. Its classes and methods provide support for many more high-level packages like GenomicRanges, ShortRead, Rsamtools, etc. <a href="http://bioconductor.org/packages/release/bioc/html/IRanges.html">Documentation</a></p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-GenomicRanges-Overview" id="TOC-GenomicRanges-Overview"></a>GenomicRanges Overview</h4><p>The <em>GenomicRanges</em> package serves as the foundation for representing genomic locations within the Bioconductor project. It is built upon the <em>IRanges</em> infrastructure and defines three major data containers - <em>GRanges, GRangesList</em> and <em>GappedAlignments</em> - which are supporting other important BioC-Seq packages including <em>ShortRead, Rsamtools, rtracklayer, GenomicFeatures</em> and <em>BSgenome</em>.&nbsp; Compared to the IRanges container, the GRanges/<em>GRangesList</em> classes are more flexible and extensible to store additional information about sequence ranges, such as chromosome identifiers (sequence space), strand information and annotation data. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p></div></div></div></div><h3><a name="TOC-Motif-Discovery" id="TOC-Motif-Discovery"></a>Motif Discovery</h3><h4><a name="TOC-cosmo" id="TOC-cosmo"></a>cosmo</h4><p>The cosmo package allows to search a set of unaligned DNA sequences for a shared motif that may function as transcription factor binding site. The algorithm extends the popular motif discovery tool MEME (Bailey and Elkan, 1995) in that it allows the search to be supervised by specifying a set of constraints that the motif to be discovered must satisfy. <a href="http://bioconductor.org/packages/release/bioc/html/cosmo.html">Documentation</a></p></div><div>
<p><span></span><span></span></p>
<div style="color: #0000ff;"><h4><a name="TOC-BCRANK" id="TOC-BCRANK"></a>BCRANK</h4><p>BCRANK is a method that takes a ranked list of genomic regions as input and outputs short DNA sequences that are overrepresented in some part of the list. The algorithm was developed for detecting transcription factor (TF) binding sites in a large number of enriched regions from high-throughput ChIP-chip or ChIP-seq experiments, but it can be applied to any ranked list of DNA sequences. Documentation</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/BCRANK.html"></a></p>
<p>rGADEM: <a href="http://bioconductor.org/packages/devel/bioc/html/rGADEM.html">Documentation</a></p><p>MotIV: <a href="http://bioconductor.org/packages/devel/bioc/html/MotIV.html">Documentation</a></p></div><h3><a name="TOC-ShortRead" id="TOC-ShortRead"></a>ShortRead</h3><p>The ShortRead package provides input, quality control, filtering, parsing, and manipulation functionality for short read sequences produced by high throughput sequencing technologies. While support is provided for many sequencing technologies, this package is primairly focused on Solexa/Illumina reads. <a href="http://bioconductor.org/packages/release/bioc/html/ShortRead.html">Documentation</a></p><h3><a name="TOC-Rsamtools" id="TOC-Rsamtools"></a>Rsamtools</h3><p>Rsamtools provides functions for parsing and inspecting samtools BAM formatted binary alignment data. SAM/BAM is quickly becoming a universal standard alignment format, and is now supported by a wide variety of alignment tools. <a href="http://bioconductor.org/help/bioc-views/2.7/bioc/html/Rsamtools.html">Documentation</a></p>
<p><a href="http://samtools.sourceforge.net/">Samtools Website</a><br /> <a href="http://bio-bwa.sourceforge.net/">BWA (Burrows-Wheeler Alignment) Website</a><br /><span style="color: #0000ff;"></span></p>
<div style="color: #000000;">&nbsp;</div></div><div>
<p><span style="color: #000000;">Additional tools for SNP analysis:&nbsp;</span></p>
<p><a href="http://bioconductor.org/help/bioc-views/release/bioc/html/snpMatrix.html">snpMatrix</a></p><h3><a name="TOC-BSgenome" id="TOC-BSgenome"></a>BSgenome</h3><p>BSgenome provides an object oriented infrastructure for interacting with a Biostring based genome sequence. BSgenome packages exist for many common genomes, and can be created to represent custom genomes. See the "How to forge a BSgenome data package" Vignette for instructions to create a new BSgenome package if a prebuilt package does not exist for your organism. <a href="http://bioconductor.org/packages/release/bioc/html/BSgenome.html">Documentation</a></p><h3><a name="TOC-rtracklayer" id="TOC-rtracklayer"></a>rtracklayer</h3><p>rtracklayer provides an interface for exporting annotation feature data to various genome browsers and file formats (such as GFF). See the Small RNA Profiling exercise for an example of using rtracklayer to visualize alignment coverage. <a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">Documentation</a></p><h3><a name="TOC-biomaRt" id="TOC-biomaRt"></a>biomaRt</h3><p>The biomaRt package, provides an interface to a growing collection of databases implementing the BioMart software suite (http:// www.biomart.org). The package enables online retrieval of large amounts of data in a uniform way without the need to know the underlying database schemas. This data is retrieved automatically via the Internet, so it's recommended that you cache the data locally, or check versions if your code will be adversely affected by updates to these data. <a href="http://bioconductor.org/packages/release/bioc/html/biomaRt.html">Documentation</a></p><h3><a name="TOC-ChIP-Seq-Analysis-Packages" id="TOC-ChIP-Seq-Analysis-Packages"></a>ChIP-Seq Analysis Packages</h3><p>Bioconductor provides various packages for analyzing and visualizing ChIP-Seq data. Only a small selection of these packages is introduced here. Additional useful introductions to this topic are: <a href="http://www.bioconductor.org/workshops/2009/SeattleJan09/ChIP-seq/">BioC ChIP-seq Case Study</a> and BioC <a href="http://www.bioconductor.org/help/course-materials/2009/SeattleNov09/ChIP-seq/">ChIP-Seq</a>.</p><h4><a name="TOC-chipseq" id="TOC-chipseq"></a>chipseq</h4><p>The chipseq package combines a variety of HT-Seq packages to a pipeline for ChIP-Seq data analysis. <a href="http://bioconductor.org/packages/release/bioc/html/chipseq.html">Documentation</a></p><h4><a name="TOC-BayesPeak" id="TOC-BayesPeak"></a>BayesPeak</h4><p>BayesPeak is a peak calling package for identifying DNA binding sites of proteins in ChIP-Seq experiments. Its algorithm uses hidden Markov models (HMM) and Bayesian statistical methods. The following sample code introduces the identification of peaks with the BayesPeak package as well as the incorporation of read coverage information obtained by the chipseq package. <a href="http://bioconductor.org/packages/release/bioc/html/BayesPeak.html">Documentation</a> [ <a href="http://www.biomedcentral.com/1471-2105/10/299">Publication</a> ]</p><h4><a name="TOC-PICS" id="TOC-PICS"></a>PICS</h4><p>The PICS package applies probabilistic inference to aligned-read ChIP-Seq data in order to identify regions bound by transcription factors. PICS identifies enriched regions by modeling local concentrations of directional reads, and uses DNA fragment length prior information to discriminate closely adjacent binding events via a Bayesian hierarchical t-mixture model. The following sample code uses the test data set from the above BayesPeak package in order to compare the results from both methods by identifying their consensus peak set. <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">Documentation</a> [ <a href="http://www.hubmed.org/display.cgi?uids=20528864">Publication</a> ]</p><h4><a name="TOC-ChIPpeakAnno" id="TOC-ChIPpeakAnno"></a>ChIPpeakAnno</h4><p>The ChIPpeakAnno package provides. batch annotation of the peaks identified from either ChIP-seq or ChIP-chip experiments. It includes functions to retrieve the sequences around peaks, obtain enriched Gene Ontology (GO) terms, find the nearest gene, exon, miRNA or custom features such as most conserved elements and other transcription factor binding sites supplied by users. The package leverages the biomaRt, IRanges, Biostrings, BSgenome, GO.db, multtest and stat packages. <a href="http://bioconductor.org/packages/release/bioc/html/ChIPpeakAnno.html">Documentation</a></p><h4><a name="TOC-Additional-ChIP-Seq-Packages" id="TOC-Additional-ChIP-Seq-Packages"></a>Additional ChIP-Seq Packages</h4><p>DiffBind: <a href="http://www.bioconductor.org/packages/release/bioc/html/DiffBind.html">Documentation</a></p><p>MOSAICS: <a href="http://bioconductor.org/packages/devel/bioc/html/mosaics.html">Documentation</a></p><p>iSeq: <a href="http://bioconductor.org/packages/release/bioc/html/iSeq.html">Documentation</a></p><p>ChIPseqR: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPseqR.html">Documentation</a></p><p>ChiPsim: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPsim.html">Documentation</a></p><p>CSAR: <a href="http://www.bioconductor.org/packages/devel/bioc/html/CSAR.html">Documentation</a></p><p>ChIP-Seq Pipeline: <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">PICS</a>, rGADEM and MotIV (<a href="http://www.rglab.org/pics-and-bioconductor/">developer web site</a>)</p><p>SPP: <a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/">ChIP-seq processing pipeline</a></p><p><a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/tutorial.html">SPP Tutorial</a></p><p><a href="http://liulab.dfci.harvard.edu/MACS/index.html">MACS</a></p><p><a href="http://gmdd.shgmo.org/Computational-Biology/ChIP-Seq/download/SIPeS">SIPeS</a></p><h3><a name="TOC-RNA-Seq-Analysis" id="TOC-RNA-Seq-Analysis"></a>RNA-Seq Analysis</h3><h4><a name="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-" id="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-"></a>Counting Reads that Overlap with Annotation Ranges&nbsp;</h4><p>The GenomicRanges package provides support for importing into R short read alignment data in BAM format (via Rsamtools) and associating them with genomic feature ranges, such as exons or genes. This way one can quantify the number of reads aligning to annotated genomic regions. The package defines general purpose containers for storing genomic intervals as well as more specialized containers for storing alignments against a reference genome. The two main functions for read counting provided by this infrastructure are <span>countOverlaps <span style="color: #000000;"><span>and</span></span> summarizeOverlaps</span>. For their proper usage, it is important to read the corresponding <a href="http://www.bioconductor.org/packages/devel/bioc/vignettes/GenomicRanges/inst/doc/summarizeOverlaps.pdf">PDF manual</a>. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-DESeq" id="TOC-Differential-Gene-Expression-Analysis-with-DESeq"></a>Differential Gene Expression Analysis with DESeq</h4><p>The DESeq package contains functions to call differentially expressed genes (DEGs) in count tables based on a model using the negative binomial distribution. It expects as input a data frame with the raw read counts per region/gene of interest (rows) for each test sample (columns).&nbsp; Such a count table can be imported into R or generated from BAM alignment files using the <span>countOverlaps</span> function as introduced above. <a href="http://www.bioconductor.org/packages/release/bioc/html/DESeq.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-edgeR" id="TOC-Differential-Gene-Expression-Analysis-with-edgeR"></a>Differential Gene Expression Analysis with edgeR</h4><p>The edgeR package uses empirical Bayes estimation and exact tests based on the negative binomial distribution to call differentially expressed genes (DEGs) in count data.&nbsp;</p>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/edgeR.html">Documentation</a></p>
<p><span style="color: #000000;">A variety of additional R packages are available for normalizing RNA-Seq read count data and identifying differentially expressed genes (DEG): <br /> </span></p><p><a href="http://bioconductor.org/packages/devel/bioc/html/easyRNASeq.html">easyRNASeq</a> (simplifies read counting per genome feature)</p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/DEXSeq.html">DEXSeq</a> (Inference of differential exon usage);&nbsp;<a href="http://www.bioconductor.org/packages/release/data/experiment/html/parathyroidSE.html">parathyroidSE</a> explains how to generate exon read counts in R</p><p><a href="http://bioconductor.org/packages/release/bioc/html/DEGseq.html">DEGseq</a></p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/baySeq.html">baySeq</a> (also see: <a href="http://www.bioconductor.org/packages/release/bioc/html/segmentSeq.html">segmentSeq</a>)</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a> (<a href="http://www.hubmed.org/display.cgi?uids=20167110">Bullard et al. 2010</a>)</p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-Detection-of-Alternative-Splice-Junctions" id="TOC-Detection-of-Alternative-Splice-Junctions"></a>Detection of Alternative Splice Junctions</h4>
<p><span style="color: #000000;">Another utility of RNA-Seq experiments is the analysis of splice junctions. The following software suggestions provide this utility:</span></p>
<p><a href="http://woldlab.caltech.edu/rnaseq/">ERANGE<br /> </a><a href="http://tophat.cbcb.umd.edu/">TopHat</a></p><p><a href="http://biogibbs.stanford.edu/%7Ekinfai/SpliceMap/">SpliceMap</a></p><p><a href="http://solidsoftwaretools.com/gf/project/splitseek/">SplitSeek</a></p><h3><a name="TOC-DNA-Methylation-Data-Analysis" id="TOC-DNA-Methylation-Data-Analysis"></a>DNA-Methylation Data Analysis</h3><div><ul>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/help/course-materials/2012/BiocEurope2012/mattia_pelizzola_methylPipe.pdf">methylPipe</a></span></li>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/packages/devel/bioc/html/bsseq.html">bsseq</a></span></li>
<li><a href="http://www.bioconductor.org/packages/devel/bioc/html/BiSeq.html">BiSeq</a></li>
<li>Much more under <a href="http://www.bioconductor.org/packages/devel/BiocViews.html#___DNAMethylation">BiocViews</a></li>
</ul></div></div></div><h3><a name="TOC-HT-Seq-Data-Visualization" id="TOC-HT-Seq-Data-Visualization"></a>HT-Seq Data Visualization</h3>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/ggbio.html">ggbio</a>: ggplot2 extension for genomics data (<a href="http://tengfei.github.com/ggbio/">online manual</a>) <a href="http://www.bioconductor.org/packages/devel/bioc/html/Gviz.html">Gviz</a>:&nbsp;Plotting data and annotation information along genomic coordinates <a href="http://bioconductor.org/packages/release/bioc/html/HilbertVis.html">HilbertVis</a>: Hilbert genome plots</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/GenomeGraphs.html">GenomeGraphs</a>: Plotting genomic information from Ensembl</p><p><a href="http://www.hubmed.org/display.cgi?uids=18507856">TileQC</a>: Flow Cell Quality Visualization</p><p><a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">rtracklayer</a>: R interface to genome browsers</p><p><a href="http://genoplotr.r-forge.r-project.org/">genoPlotR</a>: Plotting maps of genes and genomes</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a>: Tools for storing, accessing, analyzing and visualizing genomic data.</p><p>&nbsp;</p><p>To install all packages</p><blockquote><p>source("http://bioconductor.org/biocLite.R")<br />biocLite()<br />biocLite(c("ShortRead", "Biostrings", "IRanges", "BSgenome", "rtracklayer", "biomaRt", "chipseq", "ChIPpeakAnno", "Rsamtools", "BayesPeak", "PICS", "GenomicRanges", "DESeq", "edgeR", "leeBamViews", "GenomicFeatures", "BSgenome.Celegans.UCSC.ce2"))</p></blockquote></div>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>