- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)
- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio

All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.

Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html

Start date: March 1st, 2014

Duration: 1+2 years

Contact Person (Referent): Mattia Pelizzola

Ref. E-Mail: mattia.pelizzola@iit.it

Tel: 0039-02-94375058
Group Web Page: http://genomics.iit.it

The course topics will include theoretical and practical aspects in:
- Genomes comparisons,
- Evolutionary analyses (orthologs, paralogs and ancestral genomes
inference),
- RNAseq and Next Generation Sequencing (including algorithms, methods
and sequence mapping tools, data analyses and applications).

The course programme will be centred on theoretical presentations
followed by practical sessions. Practical sessions in a Linux
environment will involve Unix shell and Perl scripting. Participants
are assumed to be familiar with this environment.

A series of lectures delivered by prominent scientists on recent hot
topics in genome (Viruses, Prokaryotes, Eukaryotes) studies will be
included in the programme and future research perspectives will be
highlighted.

The topics that will be included in the course programme are similar
to those included in previously organized courses:http://www.pasteur.fr/~tekaia/BGA_courses.html

The course is aimed at motivated Ph.D students and Post-Doctoral
Researchers in Academic Institutions, with background in Mathematics,
Statistics, Biology or Computer Science and who are involved in
Bioinformatics and Genomes studies.

Selection of participants will be based on their background, running
research projects and on expressed motivations.
Selected students will have free accommodation and meals and are
expected to contribute with 200 euros and to pay for their travel
expenses.
All participants (students and invited speakers) will stay in the same
hotel.

Detailed indications are available on the course web site: http://events.embo.org/14-comparative-genomics/index.html

Candidates are advised to complete carefully the application form,
together with an abstract of at least one of their running projects, a
"one-page CV" and a personal Identity Picture (Photo).

The application deadline is March 14, 2014.

The organizers:
Menelaos Manoussakis, Hellenic Pasteur Institute, Athens, Greece.
Evdokia Karagouni, Hellenic Pasteur Institute, Athens - Greece.
Evie Melanitou, Institut Pasteur Paris - France.
Fredj Tekaia ( Institut Pasteur Paris France)
URL: http://www.pasteur.fr/~tekaia/BGA_courses.html

Date: 5 – 17 May, 2014.
More at http://events.embo.org/14-comparative-genomics/index.html
will take place in the ,

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Reference

http://www.sciencedaily.com/releases/2013/12/131204132018.htm

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

(Under Tenure-Track Model)

Open Advt. No IIITA/DIC/16012014

IIIT-Allahabad has several Openings for the Faculty positions at the Assistant Professor level.

It is a regular tenure-track faculty positions for 3-5 years in teaching and research. A regular faculty is expected to engage heavily in research and teaching. The eligibility criteria for regular faculty positions are similar as in IITs. For an Assistant Professor position, a candidate must have a PhD (in IT/Computer Science &/or Engineering/Electrical, Electronics &/or Communication Engineering/etc; for interdisciplinary areas the PhD may be in an appropriate field), plus three years experience. However, for PhDs from a well known University/Institute (e.g. IITs/IISc/TIFR/ISI in India or well known research universities across the world), and a good research/academic record, the 3 years experience requirement may be waived.

The pay scale for faculty is same as in IITs. Other benefits include initiation research grant, travel support, book grant, professional society membership, etc., and personal benefits such as medical/LTC, on campus subsidized family housing with excellent modern infrastructural facilities.

Areas of Interest

IIIT-Allahabad aims to build strong research groups in important and emerging areas in CS/IT/ECE as well as in emerging interdisciplinary areas, and applications are invited in all these areas. Some of the areas of special interest, besides strengthening the existing research areas, are : Software Engineering, Theoretical Computer Science, Cyber Physical Systems, Robotics, Network science, Digital Media, Computational neuroscience, Machine learning, Healthcare informatics, Computational Biology, Communications networks (both at hardware and protocol levels), Circuits (including VLSI, analog, low power, etc), Energy systems and technologies, Biomedical electronics and systems, Computer Architecture, signal/image processing, Embedded and control systems.

Application Process

Interested candidates can apply by sending their detailed CV with list of publications clearly mentioning Journal names and citation index with three references through email entitled “Faculty positions at IIIT Allahabad” to faculty.applications@iiita.ac.in. Do not send your applications in any other email addresses. Applications will be considered regularly, hence there is no deadline for applying.

Important Clarifications on Eligibility

A PhD in CS/IT (or other disciplines, as announced) is the minimum expected requirement for an Assistant Professor.

Advertisement: http://iiita.ac.in/pub/Faculty-Position-IIITA1.pdf

Address of the bookmark: http://www.fishbrowser.org/software/P_RNA_scaffolder/#

Address of the bookmark: http://chmille4.github.io/Scribl/

An Autonomous National Institute under Government of India,
Ministry of Science & Technology
Department of Biotechnology

No: RGCB/ Advt./2014/1
January 24, 2014

Scientist Positions

Group Leader in Computational Biology/Bioinformatics
A highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to analyze complex data sets generated by RGCB scientists and collaborators.

Location: Thiruvananthapuram (Trivandrum)

The above positions will be at the E-II, F or equivalent levels. For senior applicants with an outstanding track record, an option of a contract career path for research excellence at Scientist G or H equivalent level can also be discussed. All positions will initially be for 5 years. Essential and desired qualifications as well as other relevant details for all the above positions are posted on the RGCB website (http://www.rgcb.res.in). The last date for receiving applications is March 14, 2014.

Sd/-
Director

Rajiv Gandhi Centre for Biotechnology
Thycaud, P.O., Poojappura,
Thiruvananthapuram, Kerala, India-695 014
Ph.: 91-471-2529400 (30 Lines), 2347975, 2348104, 2348753, 2345899
Fax: 91-471-2348096, 2346333

More at http://rgcb.res.in/jobs.html