<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/29620?offset=850</link>
	<atom:link href="https://bioinformaticsonline.com/related/29620?offset=850" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7215/postdoc-positions-in-computational-biology-center-for-genomic-science-milan-italy</guid>
  <pubDate>Thu, 12 Dec 2013 18:34:47 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoc positions in computational biology - Center for Genomic Science - Milan, Italy]]></title>
  <description><![CDATA[
<p>Job Description: three postdoc positions in computational biology are available at the Center for Genomic Science in Milan (Italy):</p>

<p>- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)<br />- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio</p>

<p>All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.</p>

<p>Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html</p>

<p>Start date: March 1st, 2014</p>

<p>Duration: 1+2 years</p>

<p>Contact Person (Referent): Mattia Pelizzola</p>

<p>Ref. E-Mail: mattia.pelizzola@iit.it</p>

<p>Tel: 0039-02-94375058<br />Group Web Page: http://genomics.iit.it</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7383/embo-practical-course-on-bioinformatics-and-genomes-analyses-at-hellenic-pasteur-institute-athens-greece</guid>
  <pubDate>Sat, 21 Dec 2013 10:00:24 -0600</pubDate>
  <link></link>
  <title><![CDATA[EMBO practical Course on  "Bioinformatics and Genomes Analyses" at Hellenic Pasteur Institute, Athens, Greece]]></title>
  <description><![CDATA[
<p>The main objectives of this Practical Course are to strengthen skills <br />of PhD students and young researchers in the domain of Bioinformatics <br />and Genome Data Analyses on the use of advanced fundamental algorithms <br />and their applications in genome studies.</p>

<p>The course topics will include theoretical and practical aspects in:<br />- Genomes comparisons,<br />- Evolutionary analyses (orthologs, paralogs and ancestral genomes <br />inference),<br />- RNAseq and Next Generation Sequencing (including algorithms, methods <br />and sequence mapping tools, data analyses and applications).</p>

<p>The course programme will be centred on theoretical presentations <br />followed by practical sessions. Practical sessions in a Linux <br />environment will involve Unix shell and Perl scripting. Participants <br />are assumed to be familiar with this environment.</p>

<p>A series of lectures delivered by prominent scientists on recent hot <br />topics in genome (Viruses, Prokaryotes, Eukaryotes) studies will be <br />included in the programme and future research perspectives will be <br />highlighted.</p>

<p>The topics that will be included in the course programme are similar <br />to those included in previously organized courses:http://www.pasteur.fr/~tekaia/BGA_courses.html</p>

<p>The course is aimed at motivated Ph.D students and Post-Doctoral <br />Researchers in Academic Institutions, with background in Mathematics, <br />Statistics, Biology or Computer Science and who are involved in <br />Bioinformatics and Genomes studies.</p>

<p>Selection of participants will be based on their background, running <br />research projects and on expressed motivations.<br />Selected students will have free accommodation and meals and are <br />expected to contribute with 200 euros and to pay for their travel <br />expenses.<br />All participants (students and invited speakers) will stay in the same <br />hotel.</p>

<p>Detailed indications are available on the course web site: http://events.embo.org/14-comparative-genomics/index.html</p>

<p>Candidates are advised to complete carefully the application form, <br />together with an abstract of at least one of their running projects, a <br />"one-page CV" and a personal Identity Picture (Photo).</p>

<p>The application deadline is March 14, 2014.</p>

<p>The organizers:<br />Menelaos Manoussakis, Hellenic Pasteur Institute, Athens, Greece.<br />Evdokia Karagouni, Hellenic Pasteur Institute, Athens - Greece.<br />Evie Melanitou,  Institut Pasteur Paris - France.<br />Fredj Tekaia ( Institut Pasteur Paris France)<br />URL: http://www.pasteur.fr/~tekaia/BGA_courses.html</p>

<p>Date: 5 – 17 May, 2014. <br />More at http://events.embo.org/14-comparative-genomics/index.html<br />will take place in the ,</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/7568/oldest-hominin-dna-sequenced</guid>
	<pubDate>Fri, 27 Dec 2013 19:58:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/7568/oldest-hominin-dna-sequenced</link>
	<title><![CDATA[Oldest Hominin DNA Sequenced]]></title>
	<description><![CDATA[<p>Matthias Meyer and his team from the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, have developed new techniques for retrieving and sequencing highly degraded ancient DNA. They then joined forces with Juan-Luis Arsuaga and applied the new techniques to a cave bear from the Sima de los Huesos site. After this success, the researchers sampled two grams of bone powder from a hominin thigh bone from the cave. They extracted its DNA and sequenced the genome of the mitochondria or mtDNA, a small part of the genome that is passed down along the maternal line and occurs in many copies per cell. The researchers then compared this ancient mitochondrial DNA with Neandertals, Denisovans, present-day humans, and apes.<br /><br />From the missing mutations in the old DNA sequences the researchers calculated that the Sima hominin lived about 400,000 years ago. They also found that it shared a common ancestor with the Denisovans, an extinct archaic group from Asia related to the Neandertals, about 700,000 years ago. "The fact that the mtDNA of the Sima de los Huesos hominin shares a common ancestor with Denisovan rather than Neandertal mtDNAs is unexpected since its skeletal remains carry Neandertal-derived features," says Matthias Meyer. Considering their age and Neandertal-like features, the Sima hominins were likely related to the population ancestral to both Neandertals and Denisovans. Another possibility is that gene flow from yet another group of hominins brought the Denisova-like mtDNA into the Sima hominins or their ancestors.<br /><br /></p><p>Reference</p><p>http://www.sciencedaily.com/releases/2013/12/131204132018.htm</p>]]></description>
	<dc:creator>Surajeet</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/7986/list-of-bioinformatics-open-source-projectssoftware</guid>
	<pubDate>Tue, 21 Jan 2014 14:28:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/7986/list-of-bioinformatics-open-source-projectssoftware</link>
	<title><![CDATA[List of bioinformatics open source projects/software.]]></title>
	<description><![CDATA[<p>Open source software is software that can be freely used, changed, and shared (in modified or unmodified form) by anyone. Open source software is made by many people, and distributed under licenses that comply with the Open Source Definition.The Open Source Initiative (OSI) is a global non-profit that supports and promotes the open source movement. Followings are the OS bioinformatics projects/software :</p><p><strong>.NET Bio</strong></p><p>http://blogs.msdn.com/b/msr_er/archive/2011/10/18/microsoft-biology-foundation-evolves-into-new-toolkit-net-bio.aspx</p><p>A language-neutral bioinformatics toolkit built using the Microsoft 4.0 .NET Framework to help developers, researchers, and scientists.</p><p><strong>AMPHORA</strong> ("AutoMated Phylogenomic infeRence Application")</p><p>http://wolbachia.biology.virginia.edu/WuLab/Software.html</p><p><a href="http://en.wikipedia.org/wiki/Metagenomics" title="Metagenomics">Metagenomics</a> analysis software</p><p><strong>Anduril</strong></p><p>http://www.anduril.org/anduril/site/</p><p>Component-based <a href="http://en.wikipedia.org/wiki/Workflow" title="Workflow">workflow</a> framework for data analysis</p><p>Armadillo workflow platform</p><p>Tool for designing and executing phylogenetic workflows</p><p><strong>AutoDock</strong></p><p>http://autodock.scripps.edu/</p><p>suite of automated docking tools</p><p><strong>Biochemical Algorithms Library (BALL)</strong></p><p>http://www.ball-project.org/</p><p>C++ library and framework for molecular modeling and visualization designed for rapid prototyping</p><p><strong>Bio4j</strong></p><p>http://bio4j.com/</p><p>Bio4j is a <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a> platform and <a href="http://en.wikipedia.org/wiki/Chart" title="Chart">graph</a> based <a href="http://en.wikipedia.org/wiki/Database" title="Database">database</a> built around most data available in <a href="http://en.wikipedia.org/wiki/UniProt" title="UniProt">UniProt</a> KB(<a href="http://en.wikipedia.org/wiki/Swiss-Prot" title="Swiss-Prot">Swiss-Prot</a> + <a href="http://en.wikipedia.org/wiki/TrEMBL" title="TrEMBL">TrEMBL</a>), <a href="http://en.wikipedia.org/wiki/Gene_Ontology" title="Gene Ontology">Gene Ontology</a> (GO), <a href="http://en.wikipedia.org/w/index.php?title=UniRef&amp;action=edit&amp;redlink=1" title="UniRef (page does not exist)">UniRef</a> (50,90,100), <a href="http://en.wikipedia.org/wiki/RefSeq" title="RefSeq">RefSeq</a>, <a href="http://en.wikipedia.org/wiki/National_Center_for_Biotechnology_Information" title="National Center for Biotechnology Information">NCBI</a> taxonomy, and Expasy Enzyme DB</p><p><strong>Bioclipse</strong></p><p>www.bioclipse.net</p><p>Visual platform for <a href="http://en.wikipedia.org/wiki/Cheminformatics" title="Cheminformatics">chemo</a>- and <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a> based on the <a href="http://en.wikipedia.org/wiki/Eclipse_%28software%29" title="Eclipse (software)">Eclipse</a> Rich Client Platform (RCP).</p><p><strong>Bioconductor</strong></p><p>http://www.bioconductor.org/</p><p><a href="http://en.wikipedia.org/wiki/R_%28programming_language%29" title="R (programming language)">R (programming language)</a> language toolkit</p><p><strong>Bioinformatics Learning Tutorial (BLT)</strong></p><p>http://sourceforge.net/projects/biotutorial/</p><p>Educational <a href="http://en.wikipedia.org/wiki/Interactive_tutorials" title="Interactive tutorials">interactive tutorials</a> and 3D animations for Replication, Transcription, and Translation</p><p><strong>BioHaskell</strong></p><p>http://biohaskell.org/</p><p><a href="http://en.wikipedia.org/wiki/Haskell_%28programming_language%29" title="Haskell (programming language)">Haskell (programming language)</a></p><p><strong>BioJava</strong></p><p>http://biojava.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Java_%28programming_language%29" title="Java (programming language)">Java (programming language)</a></p><p><strong>BioMOBY</strong></p><p>http://biomoby.org/</p><p>registry of <a href="http://en.wikipedia.org/wiki/Web_services" title="Web services">web services</a></p><p><strong>BioPerl</strong></p><p>http://www.bioperl.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Perl" title="Perl">Perl</a> language toolkit</p><p><strong>BioPHP</strong></p><p>http://www.biophp.org/</p><p><a href="http://en.wikipedia.org/wiki/PHP" title="PHP">PHP</a> language toolkit</p><p><strong>Biopython</strong></p><p>http://biopython.org/wiki/Main_Page</p><p><a href="http://en.wikipedia.org/wiki/Python_%28programming_language%29" title="Python (programming language)">Python</a> language toolkit</p><p><strong>BioRails</strong></p><p>https://github.com/biorails</p><p>a <a href="http://en.wikipedia.org/wiki/Data_management_system" title="Data management system">data management system</a> designed to support researchers in <a href="http://en.wikipedia.org/wiki/Drug_discovery" title="Drug discovery">drug discovery</a></p><p><strong>BioRuby</strong></p><p>http://bioruby.org/</p><p><a href="http://en.wikipedia.org/wiki/Ruby_%28programming_language%29" title="Ruby (programming language)">Ruby</a> language toolkit</p><p><strong>BioSmalltalk</strong></p><p>https://code.google.com/p/biosmalltalk/</p><p><a href="http://en.wikipedia.org/wiki/Smalltalk_%28programming_language%29" title="Smalltalk (programming language)">Smalltalk</a> language toolkit</p><p><strong>BioUno</strong></p><p>http://www.biouno.org/</p><p><a href="http://en.wikipedia.org/w/index.php?title=BioUno&amp;action=edit&amp;redlink=1" title="BioUno (page does not exist)">BioUno</a> is a project that applies <a href="http://en.wikipedia.org/wiki/Continuous_Integration" title="Continuous Integration">Continuous Integration</a> tools and techniques in <a href="http://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">Bioinformatics</a>. It uses <a href="http://en.wikipedia.org/wiki/Jenkins_%28software%29" title="Jenkins (software)">Jenkins</a> and its plug-in API to create <a href="http://en.wikipedia.org/wiki/Bioinformatics_workflow_management_system" title="Bioinformatics workflow management system">biology workflows</a> and manage <a href="http://en.wikipedia.org/wiki/Computer_clusters" title="Computer clusters">computer clusters</a>.</p><p><strong>caCORE</strong></p><p>&nbsp;</p><p>ontologic representation environment</p><p><strong>caArray</strong></p><p>https://cabig-stage.nci.nih.gov/community/tools/caArray</p><p>ontologic representation environment</p><p><strong>EMBOSS</strong></p><p>http://emboss.sourceforge.net/</p><p>Suite of packages for sequencing, searching, etc.</p><p><strong>Gaggle</strong></p><p>https://www.gaggle.net/</p><p>A framework for interoperability between systems biology software</p><p><strong>Galaxy</strong></p><p>http://galaxyproject.org/</p><p><a href="http://en.wikipedia.org/wiki/Scientific_workflow_system" title="Scientific workflow system">Scientific workflow</a> and <a href="http://en.wikipedia.org/wiki/Data_integration" title="Data integration">data integration</a> system</p><p><strong>GenePattern</strong></p><p>http://www.broadinstitute.org/cancer/software/genepattern/</p><p><a href="http://en.wikipedia.org/wiki/Scientific_workflow_system" title="Scientific workflow system">Scientific workflow system</a> that provides access to more than 150 genomic analysis tools</p><p><strong>GeWorkbench</strong></p><p>http://wiki.c2b2.columbia.edu/workbench/index.php/Home</p><p>Genomic <a href="http://en.wikipedia.org/wiki/Data_integration" title="Data integration">data integration</a> platform</p><p><strong>GMOD</strong></p><p>http://www.gmod.org/wiki/Main_Page</p><p>Toolkit for addressing many common challenges at biological databases.</p><p><strong>GeneProf</strong></p><p>http://www.geneprof.org/GeneProf/</p><p>A web-based, bioinformatics software suite for the analysis of functional genomics experiments, e.g. RNA-seq or ChIP-seq.</p><p><strong>GeneTalk</strong></p><p>http://www.gene-talk.de/</p><p>Tool for filtering sequence variants in <a href="http://en.wikipedia.org/wiki/Variant_Call_Format" title="Variant Call Format">VCF</a> files. Network for scientists and clinicians for expertise and knowledge exchange. Database of annotations aboute sequence variants with clinically relevant information.</p><p><strong>GenGIS</strong></p><p>http://kiwi.cs.dal.ca/GenGIS/Main_Page</p><p>Application that allows users to combine digital map data with information about biological sequences collected from the environment.</p><p><strong>GenomeSpace</strong></p><p>http://www.genomespace.org/</p><p>Centralized web application that provides data format transformations and facilitates connections with other bioinformatics tools</p><p><strong>GENtle</strong></p><p>http://directory.fsf.org/wiki/GENtle</p><p>An equivalent to the proprietary <a href="http://en.wikipedia.org/wiki/Vector_NTI" title="Vector NTI">Vector NTI</a>, a tool to analyze and edit <a href="http://en.wikipedia.org/wiki/DNA" title="DNA">DNA</a> sequence files</p><p><strong>Integrated Genome Browser</strong></p><p>http://bioviz.org/igb/</p><p><a href="http://en.wikipedia.org/wiki/Java_%28software_platform%29" title="Java (software platform)">Java</a>-based desktop <a href="http://en.wikipedia.org/wiki/Genome_browser" title="Genome browser">genome browser</a></p><p><strong>Integrative Genomics Viewer (IGV)</strong></p><p>http://www.broadinstitute.org/igv/</p><p>High-performance desktop tool for interactive visual exploration of diverse genomic data</p><p><strong>IntAct</strong></p><p>http://www.ebi.ac.uk/intact/</p><p>molecular interaction database</p><p><strong>InterMine</strong></p><p>http://intermine.github.io/intermine.org/</p><p>Extensive data warehouse system for the analysis and integration of biological datasets</p><p><strong>Java Treeview</strong></p><p>http://jtreeview.sourceforge.net/</p><p>microarray data viewer</p><p><strong>LabKey Server</strong></p><p>http://labkey.com/</p><p>platform for integrating, analyzing and sharing data</p><p><strong>OpenClinica</strong></p><p>https://www.openclinica.com/</p><p>software for capturing and managing data in clinical trials</p><p><a href="http://www.biomedcentral.com/1471-2164/13/512">PromKappa</a></p><p>http://xbioinformatics.wordpress.com/tag/promkappa/</p><p>PromKappa (Promoter analysis by Kappa) software program used for promoter pattern generation and promoter analysis.</p><p><strong>MeV: Multi-Experiment Viewer</strong></p><p>http://www.tm4.org/mev.html</p><p>a desktop application for the analysis, visualization and data-mining of large-scale genomic data</p><p><strong>PathVisio</strong></p><p>http://www.pathvisio.org/</p><p>a desktop software for drawing, analysis and visualization of biological pathways</p><p>REDCRAFT</p><p>software for determining tertiary protein structure given assigned Residual Dipolar Coupling data</p><p>SAM Tools</p><p>Data format (SAM) and accompanying tool suite, for storing large nucleotide sequence alignments</p><p><a href="http://en.wikipedia.org/wiki/Staden_Package" title="Staden Package">Staden Package</a></p><p>Sequence assembly, editing and analysis, primarily consisting of gap4, gap5 and spin.</p><p><a href="http://en.wikipedia.org/wiki/STAMP" title="STAMP">STAMP</a></p><p>Software package for analyzing metagenomic profiles that promotes &lsquo;best practices&rsquo; in choosing appropriate statistical techniques and reporting results.</p><p><a href="http://supfam.org/supraHex">supraHex</a></p><p>An open-source R/Bioconductor package for omics data analysis using a supra-hexagonal map</p><p><a href="http://en.wikipedia.org/wiki/Taverna_workbench" title="Taverna workbench">Taverna workbench</a></p><p>Tool for designing and executing workflows</p><p>TGAC Browser</p><p>Genome Browser, visualisation solutions for big data in the genomic era</p><p>T-REX WebServer</p><p>Bioinformatics and phylogenetics webserver (NJ, PhyML, RAxML, MAFFT, MUSCLE, Newick viewer, <a href="http://en.wikipedia.org/wiki/Horizontal_gene_transfer" title="Horizontal gene transfer">Horizontal gene transfer</a> detection, Reticulograms, Substitution models)</p><p><a href="http://en.wikipedia.org/wiki/UGENE" title="UGENE">UGENE</a></p><p>integrated bioinformatics tools</p><p>Visomics</p><p>bioinformatics tools for omics data</p><p>Genome Analysis Toolkit 1.0 (GATK 1.0)</p><p>a software package to analyse next-generation resequencing data</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8174/the-2014-cemm-phd-program</guid>
  <pubDate>Wed, 05 Feb 2014 06:03:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[The 2014 CeMM PhD Program]]></title>
  <description><![CDATA[
<p>For our next PhD Program starting in October 2014 we are looking for exceptionally motivated PhD candidates with a keen interest in genomics and medicine and a strong interest to work in teams.</p>

<p>The 2014 CeMM PhD Program will focus on two thematic areas: INFECTION and CANCER, that are built on the pillars of epigenetics, bioinformatics and systems biology, chemical biology and the mechanism of action of drugs, high-throughput genetics, genomics and proteomics, and molecular and cell biology.</p>

<p>The choice of this strategic focus rests on the synergies between immunology, infection and cancer in pathophysiological and technological terms. It furthermore reflects the strength of the current CeMM faculty, itself built around the historical and contemporary expertise in immunology and cancer of the Medical University of Vienna.</p>

<p>As a CeMM PhD student you will get the chance to work at the cutting edge of interdisciplinary molecular medicine research and be trained by the entire CeMM and associated faculty to become one of the scientists shaping the future of molecular medicine.<br />Requirements</p>

<p>To be eligible to enroll in the CeMM PhD Program all candidates are required to have a bachelor’s or master’s degree in medicine, biology, chemistry, bioinformatics, mathematics or any scientific/technical, subject-relevant degree. Candidates do not need to have completed their degree at the time of application, however they must have obtained their final degree certificate by mid-September. The working language at CeMM is English, so excellent written and oral communication skills in English are required.<br />Timeline</p>

<p>    Applications open on 20th January and close on 20th March 2014.<br />    Two references are required to be submitted through the online system by 31st March 2014.<br />    All complete candidate applications are reviewed by the CeMM Faculty in early April.<br />    Selected candidates are invited to a Skype panel interview in late April.<br />    Shortlisted candidates are then invited to Vienna in May for a full interview process, including an opportunity to introduce yourself through a presentation and interview rounds, meet research group members, and attend an informal dinner to get to know the Faculty members and learn more about their research.<br />    Positions are offered by CeMM Faculty in June.<br />    Start of PhD Program: 1st October 2014 .</p>

<p>Contact</p>

<p>Binia Maria Günther, BEd BA<br />Human Resources Manager<br />bguenther@cemm.oeaw.ac.at</p>

<p>Catherine Lloyd, Ph.D.<br />PhD and Postdoc Program Manager<br />clloyd@cemm.oeaw.ac.at</p>

<p>More Info: www.cemm.oeaw.ac.at/phd-program/application/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8123/jrf-manit</guid>
  <pubDate>Sun, 02 Feb 2014 03:07:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ MANIT]]></title>
  <description><![CDATA[
<p>MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY BHOPAL</p>

<p>No. CSE/14/1038</p>

<p>Walk in Interview for the post of JRF under TEQIP-II</p>

<p>SN Department – Qualification Post Graduation – Time</p>

<p>1 Bio-Informatics &amp; Mathematics M.Tech Bio-informatics/M.Sc.* Maths  10.00 AM</p>

<p>2 Biological Sciences M.Sc.* in any branch of Biological Sciences 10.30 AM</p>

<p>3 Chemical Engineering M.Tech Chemical Engineering 11.00 AM</p>

<p>4 Chemistry M.Sc.* Chemistry 11.30 AM</p>

<p>5 Civil Engineering M.Tech Structure/GeoTech. /Water -Resources/Hydraulics/Environment/Transport 12.00 Noon</p>

<p>6 GIS M.Tech GIS/Civil 12.30 PM</p>

<p>7 Computer Science &amp; Engineering M.Tech CSE/Information Security 01.00 PM</p>

<p>8 Electrical Engineering M.Tech Electrical Derives 01.30 PM</p>

<p>9 Electronics &amp; Communication M.Tech Digital Communication 02.00 PM</p>

<p>10 MSME M.Tech Material Science/ Mechanical/Metallurgy 02.30 PM</p>

<p>11 Physics M.Sc.* Physics 03.00 PM</p>

<p>* M.Sc. with NET/GATE qualified</p>

<p>Resume along with one passport size photograph and relevant documents are required at the time of interview</p>

<p>Amount of Fellowship: Rs 18000/-month+ HRA</p>

<p>Duration: 31st Dec 2014 (End of TEQIP-II project)</p>

<p>Date of Interview: 7th  February 2014</p>

<p>Venue Institute Committee Room</p>

<p>Advertisement:</p>

<p>http://www.manit.ac.in/manitbhopal/Year2014/Recruitment/Advertisement%20JRF.pdf</p>
]]></description>
</item>

</channel>
</rss>