BOL: Related items

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

Roslin Bioinformatics Group

Mon, 25 Nov 2013 23:55:25 -0600

Roslin Bioinformatics Group

The Law group provides internal Institute-specific development, training and support roles for data manipulation, sequence analysis and any other aspect of the analysis of biological data using computer systems. Additionally we provide databases and applications supporting the international animal science community, particularly tools and resources for genome mapping.

Head: Andy Law. Members: John Bowman (animal facility database applications), Zen Lu (bioinformatics support), Trevor Paterson (software development)

More @ http://www.bioinformatics.ed.ac.uk/groups/roslin-bioinformatics-group

AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references

Manisha Mishra — Tue, 17 Apr 2018 16:21:20 -0500

AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

PhD at University of Calgary

Fri, 27 Dec 2013 20:24:39 -0600

Institution/Company:
University of Calgary
Location:
Calgary, AB
Job Description:

Novel diagnostic platform for detection of Osteoarthritis

I invite applications from highly motivated individuals to join my laboratory as a PhD student in Systems Biology at the University of Calgary McCaig Institute for Bone and Joint Health. This project is aimed at characterizing the networks of physical (protein-protein) interactions underlying inflammatory processes in patients with Osteoarthritis and how this differs from patients with Rheumatoid Arthritis and normal individuals. This work will eventually lead to the development of a novel diagnostic platform for the non-invasive and accurate detection of early Osteoarthritis. The selected candidate will use state-of-the-art computational methodologies to systematically analyze proteomic data, and develop /implement new algorithms to identify protein and functional interaction networks from high throughput experimental data. The individual will also benefit by working closely with experts at the UofC and UofA through an AIHS Alberta Osteoarthritis Team Grant which includes experts from all pillars of health research. The candidate will also be supported to attend bioinformatics workshops and conferences to advance and disseminate their research.
Qualifications: The ideal candidate will have a Master’s degree in Computational Biology, Bioinformatics, or equivalent with strong background knowledge of the Biological Sciences, Biochemistry, and Microbiology. The individual should additionally have experience in handling high-throughput data sets as well as programming skills. The candidate will be registered as a PhD student in Dr. Krawetz’s laboratory, located in the new state-of-the-art Health Research Innovation Centre at the UofC. The individual will have strong verbal and written skills and the ability to work efficiently in a team environment.

In addition to the outstanding research opportunities available in this setting, students also enjoy the many cultural and sporting amenities provided in the city of Calgary, and can take advantage of the unparalleled skiing and hiking in the Rocky Mountains that are less than an hour away.

Candidates must be academically competitive and will be expected to apply for external funding. The stipend is $25,000/yr. For outstanding PhD students, internal top-up award opportunities are available on a competitive basis. If interested in joining the lab, please contact Dr. Krawetz directly at rkrawetz@ucalgary.ca and provide the following information:

- Short cover letter explaining your interest in the lab
- Resume
- Scanned copy of transcript or listing of course grades
- Names and contact information for two individuals who will be willing to provide letters of reference

CrossMap: a program for convenient conversion of genome coordinates

Jit — Thu, 31 May 2018 06:00:47 -0500

CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF. CrossMap is designed to liftover genome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between species.

Address of the bookmark: http://crossmap.sourceforge.net

Postdoc positions in computational biology - Center for Genomic Science - Milan, Italy

Thu, 12 Dec 2013 18:34:47 -0600

Job Description: three postdoc positions in computational biology are available at the Center for Genomic Science in Milan (Italy):

- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)
- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio

All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.

Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html

Start date: March 1st, 2014

Duration: 1+2 years

Contact Person (Referent): Mattia Pelizzola

Ref. E-Mail: mattia.pelizzola@iit.it

Tel: 0039-02-94375058
Group Web Page: http://genomics.iit.it

assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome

Jit — Thu, 14 Jun 2018 07:31:00 -0500

Download and install MUMmer Align your assembly to a reference genome using nucmer (from MUMmer package) $ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT Consult the MUMmer manual if you encounter problems Optional: Gzip the delta file to speed up upload (usually 2-4X faster) $ gzip OUT.delta Then use the OUT.delta.gz file for upload. Upload the .delta or delta.gz file (view example) to Assemblytics Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference. The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment. http://assemblytics.com/

Address of the bookmark: http://assemblytics.com/

EMBO practical Course on "Bioinformatics and Genomes Analyses" at Hellenic Pasteur Institute, Athens, Greece

Sat, 21 Dec 2013 10:00:24 -0600

The main objectives of this Practical Course are to strengthen skills
of PhD students and young researchers in the domain of Bioinformatics
and Genome Data Analyses on the use of advanced fundamental algorithms
and their applications in genome studies.

The course topics will include theoretical and practical aspects in:
- Genomes comparisons,
- Evolutionary analyses (orthologs, paralogs and ancestral genomes
inference),
- RNAseq and Next Generation Sequencing (including algorithms, methods
and sequence mapping tools, data analyses and applications).

The course programme will be centred on theoretical presentations
followed by practical sessions. Practical sessions in a Linux
environment will involve Unix shell and Perl scripting. Participants
are assumed to be familiar with this environment.

A series of lectures delivered by prominent scientists on recent hot
topics in genome (Viruses, Prokaryotes, Eukaryotes) studies will be
included in the programme and future research perspectives will be
highlighted.

The topics that will be included in the course programme are similar
to those included in previously organized courses:http://www.pasteur.fr/~tekaia/BGA_courses.html

The course is aimed at motivated Ph.D students and Post-Doctoral
Researchers in Academic Institutions, with background in Mathematics,
Statistics, Biology or Computer Science and who are involved in
Bioinformatics and Genomes studies.

Selection of participants will be based on their background, running
research projects and on expressed motivations.
Selected students will have free accommodation and meals and are
expected to contribute with 200 euros and to pay for their travel
expenses.
All participants (students and invited speakers) will stay in the same
hotel.

Detailed indications are available on the course web site: http://events.embo.org/14-comparative-genomics/index.html

Candidates are advised to complete carefully the application form,
together with an abstract of at least one of their running projects, a
"one-page CV" and a personal Identity Picture (Photo).

The application deadline is March 14, 2014.

The organizers:
Menelaos Manoussakis, Hellenic Pasteur Institute, Athens, Greece.
Evdokia Karagouni, Hellenic Pasteur Institute, Athens - Greece.
Evie Melanitou, Institut Pasteur Paris - France.
Fredj Tekaia ( Institut Pasteur Paris France)
URL: http://www.pasteur.fr/~tekaia/BGA_courses.html

Date: 5 – 17 May, 2014.
More at http://events.embo.org/14-comparative-genomics/index.html
will take place in the ,

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Oldest Hominin DNA Sequenced

Surajeet — Fri, 27 Dec 2013 19:58:31 -0600

Matthias Meyer and his team from the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, have developed new techniques for retrieving and sequencing highly degraded ancient DNA. They then joined forces with Juan-Luis Arsuaga and applied the new techniques to a cave bear from the Sima de los Huesos site. After this success, the researchers sampled two grams of bone powder from a hominin thigh bone from the cave. They extracted its DNA and sequenced the genome of the mitochondria or mtDNA, a small part of the genome that is passed down along the maternal line and occurs in many copies per cell. The researchers then compared this ancient mitochondrial DNA with Neandertals, Denisovans, present-day humans, and apes.

From the missing mutations in the old DNA sequences the researchers calculated that the Sima hominin lived about 400,000 years ago. They also found that it shared a common ancestor with the Denisovans, an extinct archaic group from Asia related to the Neandertals, about 700,000 years ago. "The fact that the mtDNA of the Sima de los Huesos hominin shares a common ancestor with Denisovan rather than Neandertal mtDNAs is unexpected since its skeletal remains carry Neandertal-derived features," says Matthias Meyer. Considering their age and Neandertal-like features, the Sima hominins were likely related to the population ancestral to both Neandertals and Denisovans. Another possibility is that gene flow from yet another group of hominins brought the Denisova-like mtDNA into the Sima hominins or their ancestors.

Reference

http://www.sciencedaily.com/releases/2013/12/131204132018.htm